View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1048_low_76 (Length: 214)

Name: NF1048_low_76
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1048_low_76
NF1048_low_76
[»] chr1 (1 HSPs)
chr1 (1-118)||(31835564-31835682)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 31835564 - 31835682
Alignment:
1 tacaaaatctaattgtactatttcagtaaaataaaacctaaaacaatcattattcaccct-ccattttaaaaacctttctagacttgttggtagataatt 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
31835564 tacaaaatctaattgtactatttcagtaaaataaaacctaaaacaatcattattcaccctcccattttaaaaacctttctagacttgttggtagataatt 31835663  T
100 ttcgatcgccactaaattt 118  Q
    |||||||||||||||||||    
31835664 ttcgatcgccactaaattt 31835682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University