View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1048_low_77 (Length: 209)
Name: NF1048_low_77
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1048_low_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 22 - 172
Target Start/End: Original strand, 26197484 - 26197634
Alignment:
| Q |
22 |
aagccaacatccgacgaatactcacggaacgcgccggcttgtagctgtttgaactcttgatgttcttggagaatatgtttgatgaatttgaaaggataag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26197484 |
aagccaacatccgacgaatactcacggaacgcgccggcttgaagctgtttgatctcttgatgttcttggagaatatgtttgatgaatttgaaaggataag |
26197583 |
T |
|
| Q |
122 |
gtacaccaaagcttggactaggatgaacatagccaccttcaataacatgtc |
172 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26197584 |
gtacaccaaagcttggactaggacgaacatagccaccttcaataacatgtc |
26197634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University