View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10490_high_2 (Length: 250)
Name: NF10490_high_2
Description: NF10490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10490_high_2 |
 |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0194 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 27024 - 26784
Alignment:
| Q |
1 |
tattatatgaacgcataacatttaagcaatcacttaatgaatataccttgacattgaatgaataaagaactgtttgttcaatagtggtgatgtttgtgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27024 |
tattatatgaacgcataacatttaagcaatcacttaatgaatataccttgacattgaatgaataaagaactgtttgttcaatagtggtgatgtttgtgtg |
26925 |
T |
 |
| Q |
101 |
aaggataatgagctgcatatcttcaagagcagcaatggtcttgatcaactgtccaggccttctccttgagagaattttaatcattgcatcaaatcctaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26924 |
aaggataatgagctgcatatcttcaagagcagcaatggtcttgatcaactgtccaggccttctccttgagagaattttaatcattgcatcaaatcctaga |
26825 |
T |
 |
| Q |
201 |
agtttcacttctacatcagccaaacatgacttactctctgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26824 |
agtttcacttctacatcagccaaacatgacttactctctgc |
26784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University