View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10490_low_2 (Length: 300)
Name: NF10490_low_2
Description: NF10490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10490_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 50753066 - 50753355
Alignment:
| Q |
1 |
ctctctacttttgagaatggctcgcatttgcattacctttccgatgctctttgtagcaatgttctttctctctgtcgttgcacaatatccaacgacatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50753066 |
ctctctacttttgagaatggctcgcatttgcattaccttttcgatgctctttgtagcaatgttctttctctctgtcgttgcacaatatccaacggcatct |
50753165 |
T |
|
| Q |
101 |
cctaaggcttctgttgtgattaccattggcactggtccatctattgtcaactctctgtcgcctattactccaccatcgatgtcaccttctctcccaccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50753166 |
cctaaggcttctgttgtgattaccattggcactggtccatctattgtcaactctctgtcgcctattactccaccatcggtgtcaccttctctcccaccat |
50753265 |
T |
|
| Q |
201 |
catcaatttcttcccctcctgctcatgctcctgcacctcacaaaagtggtgcggcctcccatggattctccttcgccatcggaacctttg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50753266 |
catcaatttcttcccctcctgctcatgctcctgcacctcacaaaagtggtgcggcctcccatggattctccttcgccatcggaacctttg |
50753355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 270
Target Start/End: Original strand, 1861098 - 1861148
Alignment:
| Q |
220 |
tgctcatgctcctgcacctcacaaaagtggtgcggcctcccatggattctc |
270 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
1861098 |
tgctcctgctcctgcacctcgcaaaagtggtgctgtttcccatggattctc |
1861148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University