View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10491_low_4 (Length: 241)
Name: NF10491_low_4
Description: NF10491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10491_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 37530846 - 37531068
Alignment:
| Q |
1 |
catatgggctcgccctttgccggggagatgtctcaccctcagagtgcaaaacttgtgtctccgaggcaaccaaagaaatccaaagtcgatgtccatacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37530846 |
catatgggctcgccctttgccggggagatgtctcaccctcagagtgcaaaacttgtgtctccgaggcaaccaaagaaatacaaagtcgatgtccatacaa |
37530945 |
T |
|
| Q |
101 |
caaaggcggcattatatggtacgactattgcttatttaaatattcggatacggatttctttggcaagattgccaagaccaacagattctatatgtggaat |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37530946 |
caaaggcggcatcatatggtacgactattgcttatttaaatattcggatacggatttctttggcaagattgccaagaccaacagattctatatgtggaat |
37531045 |
T |
|
| Q |
201 |
ttgaataacgtgagtgacccttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37531046 |
ttgaataacgtgagtgacccttc |
37531068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 114 - 183
Target Start/End: Original strand, 37534083 - 37534152
Alignment:
| Q |
114 |
atatggtacgactattgcttatttaaatattcggatacggatttctttggcaagattgccaagaccaaca |
183 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| ||||||||||| |||||||| ||| ||||||| |
|
|
| T |
37534083 |
atatggtacgataattgcttatttaaatgctcggatatggatttctttgtcaagattgacaataccaaca |
37534152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University