View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10492_high_6 (Length: 244)
Name: NF10492_high_6
Description: NF10492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10492_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 45617713 - 45617928
Alignment:
| Q |
19 |
tatatccatgaagttatgaaaagaaatacaagtttnnnnnnnnngctagacaaaaaccctttgcacaagtacatataacagcaattgatcaattttataa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45617713 |
tatatccatgaagttatgaaaagaaatacaaatttaaaaaataagctagacaaaaaccctttgcacaagtacatataacagcaattgatcaattttataa |
45617812 |
T |
 |
| Q |
119 |
aacaatcactaattttaataaccccgtcaacaaaccatgcaagaaatgtaagttcaacttaattaacaaaattatgttccaaaacagctagacaagaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45617813 |
aacaatcactaattttaataaccccgtcaacaaaccatgcaagaaatgtaagttcaacttaattaacaaaattatgttccaaaacagctagacaagaaat |
45617912 |
T |
 |
| Q |
219 |
gttgcgtttctctctg |
234 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
45617913 |
gttgcatttctctctg |
45617928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 233
Target Start/End: Complemental strand, 17893208 - 17893127
Alignment:
| Q |
155 |
atgcaagaaatgtaagttcaacttaattaacaaaattatgttccaaaac---agctagacaagaaatgttgcgtttctctct |
233 |
Q |
| |
|
||||| |||||| ||||| |||||||||||||||||||||| ||||||| || ||||||||||||||||| |||| |||| |
|
|
| T |
17893208 |
atgcatgaaatgcaagtttaacttaattaacaaaattatgtcccaaaacggtagttagacaagaaatgttgcatttccctct |
17893127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University