View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10492_high_7 (Length: 236)
Name: NF10492_high_7
Description: NF10492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10492_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 218
Target Start/End: Original strand, 36240337 - 36240541
Alignment:
| Q |
13 |
gagatgaagtatcaatatgactaagtttattaattaacatggttaatcaaaagatgcatgctatgttgattaaggatagacatactagttggctatatgg |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36240337 |
gagatgaagtaacaatatgactaagtttattaattaacatgtttaatcaaa-gatacatgctatgttgattaaggatagacatacaagttggctatatgg |
36240435 |
T |
|
| Q |
113 |
gaattaattatagagtatagactaaatcaagaaacaggttgtttgatgtagtagggattgttttctggcgcaccaatttcatagttgcaaaatttaatgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36240436 |
gaattaattatagagtatagactaaatcaagaaacaggttgtttgatgtagtagggattgttttctggcgcaccaatttcatagttgcaaaatttaatgc |
36240535 |
T |
|
| Q |
213 |
ttggtg |
218 |
Q |
| |
|
|||||| |
|
|
| T |
36240536 |
ttggtg |
36240541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University