View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10492_low_12 (Length: 276)
Name: NF10492_low_12
Description: NF10492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10492_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 898554 - 898300
Alignment:
| Q |
1 |
gaccaaggtttcaatgattcagaagagacagagtatgtgcataattattttaggccaatgaaggcaccaaatttgagatcaagagatgggggtggtattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898554 |
gaccaaggtttcaatgattcagaagagacagagtatgtgcataattattttaggccaatgaaggcaccaaatttgagatcaagagatgggggtggtattg |
898455 |
T |
 |
| Q |
101 |
gcacctctctatgtcaaaattcaggtaaaaccgaccttggttgtgtcgaaaaagttggaattgttcggccaaatataaaacattttctctattgggattg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898454 |
gcacctct--atgtcaaaattcaggtaaaaccgaccttggttgtgtcgaaaaagttggaattgttcggccaaatataaaacattttctctattgggattg |
898357 |
T |
 |
| Q |
201 |
aaatctggacaaaggttaataatttcgtctatgatggtttgaggtagctgagtatag |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898356 |
aaatctggacaaaggttaataatttcgtctatgatggtttgaggtagctgagtatag |
898300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University