View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10492_low_13 (Length: 271)
Name: NF10492_low_13
Description: NF10492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10492_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 40 - 186
Target Start/End: Original strand, 42395732 - 42395878
Alignment:
| Q |
40 |
actaatgtgaggtaaatatttagagaggtgacttaccatgttcatgaatcctacatgcaaaacttgtgtttttcctggttgttgctttcttgagctccat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42395732 |
actaatgtgaggtaaatatttagagaggtgacttaccatgttgatgaaccctacatgcaaaacttgtgtttttcctggttgttgctttcttgtgctccat |
42395831 |
T |
|
| Q |
140 |
tttagcagttgcagtagtttctttggctgcagttacaagaagaacca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42395832 |
tttagcagttgcagtagtttctttggctgcagttaaaagaagaacca |
42395878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 228 - 271
Target Start/End: Original strand, 42395880 - 42395923
Alignment:
| Q |
228 |
attaattgaaggctgtgtatgagaagaagagtatatgttattac |
271 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42395880 |
attaattgaaggttgtgtatgagaagaagagtatatgttattac |
42395923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University