View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10492_low_19 (Length: 218)
Name: NF10492_low_19
Description: NF10492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10492_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 42396121 - 42396173
Alignment:
| Q |
154 |
gtaacttgtaagaatcttccctccataaaaggacaaatttaattagggtccta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42396121 |
gtaacttgtaagaatcttccctccataaaaagacaaatttaattagggtccta |
42396173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 42396000 - 42396053
Alignment:
| Q |
1 |
tatttgctagtagtatattcttgcaaacagctagctgtccgtccaatgaaatgaaa |
56 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42396000 |
tatttgctagt--tatattcttgcaaacagctagctgtccgtccaatgaaatgaaa |
42396053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University