View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10492_low_23 (Length: 203)
Name: NF10492_low_23
Description: NF10492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10492_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 2786088 - 2785917
Alignment:
| Q |
19 |
aatacctaatgtgaatgtgactcctgctactgtaaaagttgagccagtgcctgtaaaagttgagccattgccggtaaaagttgagcgtggcgtaaaaatt |
118 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2786088 |
aatacctaatgtcagtgtgactcctgctactgtaaaagctgagccagtgcctgtaaaagttgagccattgccggtaaaagttgagcgtgtcgtaaaaatt |
2785989 |
T |
 |
| Q |
119 |
gagcgtggcacggcattttctggaccatcagtaattactagttcgggatatcttactgcttctacacaggtt |
190 |
Q |
| |
|
|||||||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2785988 |
gagcgtggcacgacatcttctggaccgccagtaattactagttcgggatatcttactgcttctacacaggtt |
2785917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 190
Target Start/End: Original strand, 22520289 - 22520342
Alignment:
| Q |
137 |
tctggaccatcagtaattactagttcgggatatcttactgcttctacacaggtt |
190 |
Q |
| |
|
|||||||| |||||||| |||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
22520289 |
tctggaccgtcagtaataactagttctggatctcttactgcttctgcacaggtt |
22520342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University