View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10492_low_23 (Length: 203)

Name: NF10492_low_23
Description: NF10492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10492_low_23
NF10492_low_23
[»] chr1 (1 HSPs)
chr1 (19-190)||(2785917-2786088)
[»] chr5 (1 HSPs)
chr5 (137-190)||(22520289-22520342)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 2786088 - 2785917
Alignment:
19 aatacctaatgtgaatgtgactcctgctactgtaaaagttgagccagtgcctgtaaaagttgagccattgccggtaaaagttgagcgtggcgtaaaaatt 118  Q
    |||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
2786088 aatacctaatgtcagtgtgactcctgctactgtaaaagctgagccagtgcctgtaaaagttgagccattgccggtaaaagttgagcgtgtcgtaaaaatt 2785989  T
119 gagcgtggcacggcattttctggaccatcagtaattactagttcgggatatcttactgcttctacacaggtt 190  Q
    |||||||||||| ||| |||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
2785988 gagcgtggcacgacatcttctggaccgccagtaattactagttcgggatatcttactgcttctacacaggtt 2785917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 190
Target Start/End: Original strand, 22520289 - 22520342
Alignment:
137 tctggaccatcagtaattactagttcgggatatcttactgcttctacacaggtt 190  Q
    |||||||| |||||||| |||||||| |||| ||||||||||||| ||||||||    
22520289 tctggaccgtcagtaataactagttctggatctcttactgcttctgcacaggtt 22520342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University