View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10493_low_14 (Length: 255)
Name: NF10493_low_14
Description: NF10493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10493_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 25025412 - 25025632
Alignment:
| Q |
18 |
aataagacaaacaagtttatagattatagaaaagatgaataaattaatcgaatgcgtgcgttcaatttaatctcttagggaacnnnnnnnctgttgcatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25025412 |
aataagacaaacaagtttatagattatagaaaaaatgaataaattaatcgaatgcgtgcgttcaatttaatctcttagggaacaaaaaaactgttgcatt |
25025511 |
T |
 |
| Q |
118 |
gcgttcatctaagcatggaatttgatgttataattagaataactagaaattgtatgactgacataccaatcagtgtttggatccaagttactttgatttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25025512 |
gcgttcatctaagcatggaatttgatgttataattagaataactagaaattgtatgactgacataccaatcagtgtttggatccaagttactttgatttt |
25025611 |
T |
 |
| Q |
218 |
tattttacttttcattctctg |
238 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
25025612 |
tattttatttttcattctctg |
25025632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University