View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10493_low_7 (Length: 380)
Name: NF10493_low_7
Description: NF10493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10493_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 3e-33; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 282 - 362
Target Start/End: Complemental strand, 32067622 - 32067542
Alignment:
| Q |
282 |
atgatttgtttaattgtggcatggtacattcagtatctaagtaatggacggttcaaaaatgctgatcaccaagcagtggtg |
362 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32067622 |
atgatttgtttaattgtggcgtggtacatgcagtatctaagtaatggacggttcaaaaatgctgatcaccaagcagtggtg |
32067542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 282 - 362
Target Start/End: Complemental strand, 32090637 - 32090557
Alignment:
| Q |
282 |
atgatttgtttaattgtggcatggtacattcagtatctaagtaatggacggttcaaaaatgctgatcaccaagcagtggtg |
362 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32090637 |
atgatttgtttaattgtggcgtggtacatgcagtatctaagtaatggacggttcaaaaatgctgatcaccaagcagtggtg |
32090557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 312 - 361
Target Start/End: Complemental strand, 32070563 - 32070514
Alignment:
| Q |
312 |
cagtatctaagtaatggacggttcaaaaatgctgatcaccaagcagtggt |
361 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32070563 |
cagtttctaagtaatggacggttcaaaaatcctgatcaccaagcagtggt |
32070514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 263
Target Start/End: Complemental strand, 32070647 - 32070608
Alignment:
| Q |
224 |
attactttaatcattttatgatttgctgctattgcatggg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32070647 |
attactttaatcattttatgatttgctgctattgcatggg |
32070608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 32067758 - 32067708
Alignment:
| Q |
166 |
tcacacttcacgtggccaatttaaattttcacaaatctttgaaaatggttt |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
32067758 |
tcacatttcacgtggccaatttaaattttcgcaaatcattgaaaatggttt |
32067708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 82 - 145
Target Start/End: Complemental strand, 32070983 - 32070921
Alignment:
| Q |
82 |
aatactaaaattattagaagggatcccggaagaaattttgtagactttgaaatcttttttgtca |
145 |
Q |
| |
|
|||||||||||||||||||||||| || ||| | || |||||||||||||| ||||||||||| |
|
|
| T |
32070983 |
aatactaaaattattagaagggattcctcaag-atttgtgtagactttgaaaacttttttgtca |
32070921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 350
Target Start/End: Complemental strand, 23307624 - 23307575
Alignment:
| Q |
301 |
catggtacattcagtatctaagtaatggacggttcaaaaatgctgatcac |
350 |
Q |
| |
|
|||||| ||| |||||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
23307624 |
catggtgcatgcagtatttaagtaatggacggttcaagaaagctgatcac |
23307575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University