View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10493_low_9 (Length: 344)
Name: NF10493_low_9
Description: NF10493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10493_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 66 - 326
Target Start/End: Complemental strand, 53089765 - 53089489
Alignment:
| Q |
66 |
aaaaacattttgggcatcttagagattaataaggattatctgacagtctaatttcctcatgatcacttgtttatggtttaaaatttacacttccacacat |
165 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089765 |
aaaatcattttgggcatcttagagattaattaggattatctgacggtctaatttcctcatgatcacttgtttatggtttaaaatttacacttccacacat |
53089666 |
T |
|
| Q |
166 |
gattaatagtttattgttgttcgtct----------------atagattcacaatggagcaaatgaaaatggggttgatcagtcttcaagggttgaaaac |
249 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089665 |
gattaataatttattgttgttcgtctccatgtcttctaatatatagattcacaatggagcaaatgaaaatggggttgatcagtcttcaagggttgaaaac |
53089566 |
T |
|
| Q |
250 |
gttacagctgagctggaggaaacacgagaaaatctagagaaagctaaagaagaaagcatgttgatggcacattgtat |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089565 |
gttacagctgagctggaggagacacgagaaaatctagagaaagctaaagaagaaagcatgttgatggcacattgtat |
53089489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 53089891 - 53089819
Alignment:
| Q |
1 |
tatactcaaattattaatcatttggtcagaaaaattaattattgacccgtaggtatgtaaaaagtaaaaacat |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089891 |
tatactcaaattattaatcatttggtcagaaaaattaattattgacccgtaggtatgtaaaaagtaaaaacat |
53089819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University