View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10494_low_1 (Length: 424)
Name: NF10494_low_1
Description: NF10494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10494_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 337
Target Start/End: Complemental strand, 17681931 - 17681590
Alignment:
| Q |
1 |
ctccactttggatttgatgtccacacattcttgcttgaacgggattgcctcctctgctgctttcgctactttgtcggccagctggatcaactttgctagt |
100 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
17681931 |
ctccactttggatctgatatccccacattcttgtttgaacgggattgccttctctgctgctttcgctactttgtcggccagctggaccaaatttgctagc |
17681832 |
T |
 |
| Q |
101 |
ttttgtttcactacatcattgttttcacccatttgaatttgtt-----gatacaaagagtatattcaaatgcgtattctaattctcctactgcctaacac |
195 |
Q |
| |
|
|| |||||| || |||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17681831 |
attcgtttcaaagaataattgtttttacccatttgaatttgatttgatgatacaaagagtatattcaaatgcgtattctaattctcctactgcctaacac |
17681732 |
T |
 |
| Q |
196 |
ttcttcttttatcatcggattaagcttcaacggataaaacattcttagccacacatagctttactcagtctagtcaaaccgcgtactttgtccaccagct |
295 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
17681731 |
ttcttcttttatcatcggattaagctgcaacggacaaaacattcttagccacacatagccttactcagtctaatcaaaccgcgtactttgtccgacagct |
17681632 |
T |
 |
| Q |
296 |
cgatcgaacctgctagtaattgcttcacagattcgttacccc |
337 |
Q |
| |
|
||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
17681631 |
gaatcgaacatgcttgtaattgcttcacatattcgttacccc |
17681590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 368 - 411
Target Start/End: Complemental strand, 17681470 - 17681427
Alignment:
| Q |
368 |
gggttaagctgcgcaacagacaaaacatgtctttttcttactct |
411 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
17681470 |
gggttaagcttcgcagcagacaaaacatgtctttttcttactct |
17681427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University