View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10494_low_15 (Length: 228)
Name: NF10494_low_15
Description: NF10494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10494_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 49466136 - 49466330
Alignment:
| Q |
15 |
gagaagaagatagttgagttcaattttgctataattgacatgctgtttggtgtactgtttgtgtcctgcttttacccattatgaagaccaggtacaaaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49466136 |
gagaagaagatagttgagttcaattttgctataattgacatgctgtttggtgtactgtttgtgtcctgcttttacccattatgaagaccaggtacaaaag |
49466235 |
T |
 |
| Q |
115 |
aatatcttctgattaaagaagagttgaggaaggtattgacaaagggaaaggctgcaggtgtgcttcgtttggttttccatgatgctggaactttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49466236 |
aatatcttctgattaaagaagagttgaggaaggtattgacaaagggaaaggctgcaggtgtgcttcgtttggttttccatgatgctggaactttt |
49466330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 52087769 - 52087820
Alignment:
| Q |
158 |
gggaaaggctgcaggtgtgcttcgtttggttttccatgatgctggaactttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52087769 |
gggaaaggctgcaggtgtgcttcgtttggttttccatgatgctggaactttt |
52087820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University