View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10496_high_30 (Length: 232)
Name: NF10496_high_30
Description: NF10496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10496_high_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 42545351 - 42545190
Alignment:
| Q |
1 |
gtcagtagatgagttcaaataagccaatctaagcaggcccataagcactt---------------gagctataaattaaattaagctatttatccaaaca |
85 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42545351 |
gtcactagatgagttcaaataagccaatctaagcaggcccataagcacttatatgataagcacttgagctataaattaaattaagctatttatccaaaca |
42545252 |
T |
|
| Q |
86 |
aggccttgaactgtattgctgtttaaggaatagatcatgatgttttgagtaataaataggag |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42545251 |
aggccttgaactgtattgctgtttaaggaatagatcatgatgttttgagtaataaattggag |
42545190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 147
Target Start/End: Complemental strand, 42536944 - 42536860
Alignment:
| Q |
64 |
aattaagctatttatccaaacaaggccttgaactgtattgct-gtttaaggaatagatcatgatgttttgagtaataaataggag |
147 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| || | |||||||||||||||||||| | ||||||||| | ||||||| |
|
|
| T |
42536944 |
aattaagctatttatccaaacaagaccttagactgttttcattgtttaaggaatagatcatgaggatttgagtaacatataggag |
42536860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 50
Target Start/End: Complemental strand, 19679693 - 19679657
Alignment:
| Q |
14 |
ttcaaataagccaatctaagcaggcccataagcactt |
50 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
19679693 |
ttcaaataagccaatccaaccaggcccataagcactt |
19679657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University