View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10496_low_11 (Length: 361)
Name: NF10496_low_11
Description: NF10496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10496_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 8e-80; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 35392384 - 35392234
Alignment:
| Q |
7 |
gtggaagctgctttaatccaaacacacttcaaagtcatgcttcatatgcttttgatagcttctatagaaacaagggccaaaaccctagtgcctgtaattt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35392384 |
gtggaagctgctttaatccaaacacacttcaaagtcatgcttcatatgcttttgatagcttctatagaaacaagggccaaaaccctagtgcctgtaattt |
35392285 |
T |
 |
| Q |
107 |
tggtggccttgcaaccattgccgtaactgacccaagtatgaacaaatgctc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35392284 |
tggtggccttgcaaccattgccgtaactgacccaagtatgaacaaatgctc |
35392234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 7 - 152
Target Start/End: Complemental strand, 35403154 - 35403009
Alignment:
| Q |
7 |
gtggaagctgctttaatccaaacacacttcaaagtcatgcttcatatgcttttgatagcttctatagaaacaagggccaaaaccctagtgcctgtaattt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
35403154 |
gtggaagctgctttaatccaaacacacttcaaagtcatgcttcatatgcttttgatagcttctatcaaagcaaaggccaaaaccctagtgcctgtaattt |
35403055 |
T |
 |
| Q |
107 |
tggtggccttgcaaccattgccgtaactgacccaagtatgaacaaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||| ||||||| |
|
|
| T |
35403054 |
tggtggccttgcaaccattgccgtaactgatcccagtacgaacaaa |
35403009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 220 - 330
Target Start/End: Complemental strand, 35392171 - 35392061
Alignment:
| Q |
220 |
acaaaaccgtaaaatattgatttggtctactnnnnnnnntttgtttcannnnnnnaaaaatattgcttagagtccttttagatgagataactttgacttt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35392171 |
acaaaaccgtaaaatattgatttggtctactaaaaaaaatttgtttcattttttttaaaatattgcttagagtccttttagatgagataactttgacttt |
35392072 |
T |
 |
| Q |
320 |
ggttttccctc |
330 |
Q |
| |
|
||||||||||| |
|
|
| T |
35392071 |
ggttttccctc |
35392061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 22 - 58
Target Start/End: Complemental strand, 35388639 - 35388603
Alignment:
| Q |
22 |
atccaaacacacttcaaagtcatgcttcatatgcttt |
58 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
35388639 |
atccaaacacacttcaaaatcatgcttcctatgcttt |
35388603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University