View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10496_low_29 (Length: 242)
Name: NF10496_low_29
Description: NF10496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10496_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 34898722 - 34898494
Alignment:
| Q |
1 |
ttacttgaccaaaaaa-gaaactattgttgtttctgaacggaagttaatttctcttcgttcgacaatcaaggaactatttcaattcgaacccgttacact |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34898722 |
ttacttgaccaaaaaaagaaactattgttgtttctgaacggaagttaatttcccttcgttcgacaatcaaggaactatttcaattcgaacccgttacact |
34898623 |
T |
|
| Q |
100 |
tcatatgcttcaatgtttatctttgctcttggctattgatactagttcaacatttttcactgtgattatatgatctttattttgaccattccttatttta |
199 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34898622 |
tcatatgcttctatgtttatctttgctcttggctattgatactagttcaacatttttcactgtgattatatgatctttattttgaccattccttatttta |
34898523 |
T |
|
| Q |
200 |
tagaggcactggatgtcataatttatttg |
228 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
34898522 |
tagaggcattggatgtcataatttatttg |
34898494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 103 - 205
Target Start/End: Original strand, 46115140 - 46115242
Alignment:
| Q |
103 |
tatgcttcaatgtttatctttgctcttggctattgatactagttcaacatttttcactgtgattatatgatctttattttgaccattccttattttatag |
202 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46115140 |
tatgcttccatgtttatctctgctcttggctacagatactgattcaacatttttcactgtgattgtatgatctttattttgaacattccttattttatag |
46115239 |
T |
|
| Q |
203 |
agg |
205 |
Q |
| |
|
||| |
|
|
| T |
46115240 |
agg |
46115242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University