View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10496_low_31 (Length: 235)
Name: NF10496_low_31
Description: NF10496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10496_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 7 - 176
Target Start/End: Complemental strand, 36626698 - 36626529
Alignment:
| Q |
7 |
acctttggaaaatagtgatgtaaactgtcacagggatttaggagattaaaaatatctttcaacagaggtttgaaatatgcaatagaagtagtttggttga |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36626698 |
acctttggaaaatagtgatgtaaactatcatagggatttaggagattaaaaatatcttccaacagaggtttgaaatatgcaatagaagtagtttggttga |
36626599 |
T |
|
| Q |
107 |
gaaccgccattgaaacaagataatgatctatgttttcatccacatctcactcaaacttagtcgttttaga |
176 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36626598 |
gaaccgccattgaaaatagataatgagctatgttttcatccacatttcactcaaatttagtcgttttaga |
36626529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University