View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10496_low_39 (Length: 209)
Name: NF10496_low_39
Description: NF10496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10496_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 26 - 191
Target Start/End: Complemental strand, 38063611 - 38063446
Alignment:
| Q |
26 |
cacaaatgggaccctaaaaaacagaaaaagtgcgcgtgctataagaagctaagatgctggagtgaatgatagtaaggaacaaacaaaaggaacctaaaag |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38063611 |
cacaaatgggaccctaaaaaacagaaaaagtgcgcgtgctataagaagctaagatgctggagtgaatgatagtaaggaacaaacaaaaggaacctaaaag |
38063512 |
T |
 |
| Q |
126 |
gtggtgactactttggcatctttcactgtcatactgacaaatgagaagaaatgtattgtacaccgt |
191 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38063511 |
atggtgactactttcgcatctttcactgtcatactgacaaatgagaagaaatgtattgtacaccgt |
38063446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University