View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10498_high_19 (Length: 242)

Name: NF10498_high_19
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10498_high_19
NF10498_high_19
[»] chr5 (2 HSPs)
chr5 (143-229)||(3939321-3939407)
chr5 (20-82)||(3939009-3939071)


Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 3939321 - 3939407
Alignment:
143 ttcgttttgaactggtatgagtgtcacttctcactagctaaatttacaataattgtcaaacttcactttaaattctaatgtttgtct 229  Q
    |||||||||  ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
3939321 ttcgttttggtctggtatgagtgtcacttctcactagctaaagttacaataattgtcaaacttcactttaaattctaatgtttgtct 3939407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 3939009 - 3939071
Alignment:
20 aagttgaagtcactgaaaatgtatatctgtcctcagttagattttcccctactcaaaactctc 82  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3939009 aagttgaagtcactgaaaatgtatatctgtcctcagttagattttcccctactcaaaactctc 3939071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University