View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_high_19 (Length: 242)
Name: NF10498_high_19
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 3939321 - 3939407
Alignment:
| Q |
143 |
ttcgttttgaactggtatgagtgtcacttctcactagctaaatttacaataattgtcaaacttcactttaaattctaatgtttgtct |
229 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3939321 |
ttcgttttggtctggtatgagtgtcacttctcactagctaaagttacaataattgtcaaacttcactttaaattctaatgtttgtct |
3939407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 3939009 - 3939071
Alignment:
| Q |
20 |
aagttgaagtcactgaaaatgtatatctgtcctcagttagattttcccctactcaaaactctc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3939009 |
aagttgaagtcactgaaaatgtatatctgtcctcagttagattttcccctactcaaaactctc |
3939071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University