View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_high_21 (Length: 239)
Name: NF10498_high_21
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_high_21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 45519885 - 45519662
Alignment:
| Q |
16 |
aatgatgtggtaactttgtaaattatctttttcccctaacatatcaaccaacacacaagaatgcacatacatgatatcatcacaggctttccattgcagt |
115 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45519885 |
aatgatatggtaactttgtaaagtatctttttcccctaacatatcaaccaacacacaagaatgcacatacatgatatcatcacaggctttccattgcagt |
45519786 |
T |
 |
| Q |
116 |
ggatttgttaacctttcacctgcccttacttaattctccatattcacaatctgactaatatccaccaaaacttctacttaattagcttgaattaacaata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45519785 |
ggatttgttaacctttcacctgcccttacttaattctccatattcacaatctgactaatatccaccaaaaattctacttaattagcttgaattaacaata |
45519686 |
T |
 |
| Q |
216 |
tggcatattccacaccctctcacc |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45519685 |
tggcatattccacaccctctcacc |
45519662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University