View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_high_26 (Length: 222)
Name: NF10498_high_26
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 11 - 207
Target Start/End: Original strand, 9721503 - 9721708
Alignment:
| Q |
11 |
gtgagatgaagtggtggagtttttgttcctgttctctctggtgaataatgcattggtggagggctcatgaataatggcaactttggtatctttttgccat |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9721503 |
gtgatatgaagtggtggagtttttgttcctgatctctctggtgaataatgcattggtggagggctcatgaataatggcaactttggtatctttttgccat |
9721602 |
T |
 |
| Q |
111 |
tttcttcctcacaagcttccatcaatactctctttgtattcaatctaggtcttaggatttttggttacat---------aataatgtaatgtggcaatgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9721603 |
tttcttcctcacaagcttccatcaatactctctttgtattcaatctaggtcttaggatttttggttacatatagtggaaaataatgtaatgtggcaatgt |
9721702 |
T |
 |
| Q |
202 |
tgaaga |
207 |
Q |
| |
|
|||||| |
|
|
| T |
9721703 |
tgaaga |
9721708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University