View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_high_29 (Length: 208)
Name: NF10498_high_29
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 6 - 193
Target Start/End: Original strand, 47333175 - 47333362
Alignment:
| Q |
6 |
attacttgcttttcctttgttttggagttcgaagccgattttgtcagaatcagttgaagggcatgaacaaagttcacctatgaaagtttggaattttgtg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47333175 |
attacttgcttttcctttgttttggagttcgaagccggttttgtcagaatcagttgaagggcatgaacaaagttcacctatgaaagtatggaattttgtg |
47333274 |
T |
|
| Q |
106 |
tatcctgatgcacctggtgggattgataaccctttgatcaatcctttggctattgatgctccaagtttggatattattggttgtccta |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47333275 |
tatcctgatgcacctggtgggattgataaccctttgatcaatcctttggctattgatgctccaagtttggatattattggttgtccta |
47333362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 91 - 150
Target Start/End: Original strand, 47301704 - 47301763
Alignment:
| Q |
91 |
gtttggaattttgtgtatcctgatgcacctggtgggattgataaccctttgatcaatcct |
150 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||| ||| |||| |||||| |
|
|
| T |
47301704 |
gtttggaattttgtgtatccttcagcacccggtgggattgataatcctatgattaatcct |
47301763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 91 - 150
Target Start/End: Original strand, 17841841 - 17841900
Alignment:
| Q |
91 |
gtttggaattttgtgtatcctgatgcacctggtgggattgataaccctttgatcaatcct |
150 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||| ||| |||| |||||| |
|
|
| T |
17841841 |
gtttggaattttgtgtatccttcagcaccttgtgggattgataatcctatgattaatcct |
17841900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 175
Target Start/End: Complemental strand, 653632 - 653540
Alignment:
| Q |
83 |
ctatgaaagtttggaattttgtgtatcctgatgcacctggtgggattgataaccctttgatcaatcctttggctattgatgctccaagtttgg |
175 |
Q |
| |
|
|||| ||||| ||||| |||||||| ||| ||||| |||||||||||||||||| || | ||||||| ||||||| ||| || ||||||| |
|
|
| T |
653632 |
ctattaaagtgtggaactttgtgtaccctaatgcaaagggtgggattgataaccctatggttaatccttgtgctattggtgcacctagtttgg |
653540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University