View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10498_high_29 (Length: 208)

Name: NF10498_high_29
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10498_high_29
NF10498_high_29
[»] chr1 (2 HSPs)
chr1 (6-193)||(47333175-47333362)
chr1 (91-150)||(47301704-47301763)
[»] chr7 (1 HSPs)
chr7 (91-150)||(17841841-17841900)
[»] chr5 (1 HSPs)
chr5 (83-175)||(653540-653632)


Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 6 - 193
Target Start/End: Original strand, 47333175 - 47333362
Alignment:
6 attacttgcttttcctttgttttggagttcgaagccgattttgtcagaatcagttgaagggcatgaacaaagttcacctatgaaagtttggaattttgtg 105  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
47333175 attacttgcttttcctttgttttggagttcgaagccggttttgtcagaatcagttgaagggcatgaacaaagttcacctatgaaagtatggaattttgtg 47333274  T
106 tatcctgatgcacctggtgggattgataaccctttgatcaatcctttggctattgatgctccaagtttggatattattggttgtccta 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47333275 tatcctgatgcacctggtgggattgataaccctttgatcaatcctttggctattgatgctccaagtttggatattattggttgtccta 47333362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 91 - 150
Target Start/End: Original strand, 47301704 - 47301763
Alignment:
91 gtttggaattttgtgtatcctgatgcacctggtgggattgataaccctttgatcaatcct 150  Q
    |||||||||||||||||||||   ||||| |||||||||||||| ||| |||| ||||||    
47301704 gtttggaattttgtgtatccttcagcacccggtgggattgataatcctatgattaatcct 47301763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 91 - 150
Target Start/End: Original strand, 17841841 - 17841900
Alignment:
91 gtttggaattttgtgtatcctgatgcacctggtgggattgataaccctttgatcaatcct 150  Q
    |||||||||||||||||||||   |||||| ||||||||||||| ||| |||| ||||||    
17841841 gtttggaattttgtgtatccttcagcaccttgtgggattgataatcctatgattaatcct 17841900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 175
Target Start/End: Complemental strand, 653632 - 653540
Alignment:
83 ctatgaaagtttggaattttgtgtatcctgatgcacctggtgggattgataaccctttgatcaatcctttggctattgatgctccaagtttgg 175  Q
    |||| ||||| ||||| |||||||| ||| |||||   |||||||||||||||||| || | |||||||  ||||||| ||| || |||||||    
653632 ctattaaagtgtggaactttgtgtaccctaatgcaaagggtgggattgataaccctatggttaatccttgtgctattggtgcacctagtttgg 653540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University