View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_12 (Length: 363)
Name: NF10498_low_12
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_12 |
 | |
|
| [»] scaffold0004 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0004 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Original strand, 374712 - 375065
Alignment:
| Q |
1 |
ctgtcgggaacattgctggttctttgattgcttctgctatgttgggatatggatggggatggtctttcgttgtgcccggattaataatgtctttccttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
374712 |
ctgtcgggaacattgctggttctttgattgcttctgctatgttgggatatggatggggatggtcttttgttgtgcctggattaataatgtctttccttgg |
374811 |
T |
|
| Q |
101 |
tttggtggttttcctaatattgcctgtctcacctgagtctgccggagtcgaagaagatgattatagttgtcctaagaaaagcggagatgatgtcacagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374812 |
tttggtggttttcctaatattgcctgtctcacctgagtctgccggagttgaagaagatgattatagttgtcctaagaaaagcggagatgatgtcacagaa |
374911 |
T |
|
| Q |
201 |
tctctcttaaggcaagaaactcctgctgaagagaaagagaaagcagttgggtttatcgaggcatggagaattcctggggtcgctccttttgctttttgtc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374912 |
tctctcttaaggcaagaaactcctgctgaagagaaagagaaagcagttgggtttatcgaggcatggagaattcctggggtcgctccttttgctttttgtc |
375011 |
T |
|
| Q |
301 |
tgtttttcgccaaattggttgcatatacctttctctattggctaccattctatg |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
375012 |
tgtttttcgccaaattggttgcatatacctttctctattggctaccattctatg |
375065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University