View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_17 (Length: 348)
Name: NF10498_low_17
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 4 - 331
Target Start/End: Original strand, 420759 - 421086
Alignment:
| Q |
4 |
tgtggttgaggtggagggtaagaagaagcagttgatgaccctccatgaacagcccgtgggtcgaagaaggactgatggatattatggtgctgctgggcgt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
420759 |
tgtggttgaggtggagggtaagaagaagcagttgatgaccctccatgaaaagcccgtgggtcgaagaaggactgatggatattatggtgctgctggttgt |
420858 |
T |
|
| Q |
104 |
gtgggctaaactggttgtggtgatgagtaaaatcaccactgtttatgtcgatggtgggtccaccaccaggtccgttaaggtagttgtcggataacatagc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
420859 |
gtgggctaaactggttgtggtgatgagtaaaatcaccactgtttatgtcgatggtgggtccaccaccaggtccgttaaggtagttgtcggataacatagc |
420958 |
T |
|
| Q |
204 |
ttgagaagcatagtggtcgaagatttgacggtgggcttgatcggtggctgctgcaccggagttgtcttcatttccggtaagcatgatgtttgatgggtta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
420959 |
ttgagaagcatagtggtcgaagatttgacggtgggcttgatcggtggctgctgcaccggagttgtcttcatttccggtaagcatgatgtttgatgggtta |
421058 |
T |
|
| Q |
304 |
ccccattcatagtccaacatgtctctct |
331 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
421059 |
ccccattcatagtccaacatgtctctct |
421086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University