View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_20 (Length: 320)
Name: NF10498_low_20
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 9 - 183
Target Start/End: Complemental strand, 6179856 - 6179682
Alignment:
| Q |
9 |
agcataggtggtatacatggcaatcattcatgtgtcggaggccgaggaaccaacatccccctaacgatgccttgagatgaaacgactctgcactctacct |
108 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||| | || |
|
|
| T |
6179856 |
agcataggtggtatacatggcaaacatccatgtgtcggaggccgaggaaccaacatctccctaacgatgccttaagatgaaatgactctgcactccatct |
6179757 |
T |
|
| Q |
109 |
ctcttctatatgattcaatactatgttttggaacagaggaaggttccaactcaaaattgtcccttttgtctccgc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6179756 |
ctcttctatatgattcaatactatgttttggaatagaggaaggttccaactcaaaattgccccttttgtctccgc |
6179682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 179 - 320
Target Start/End: Complemental strand, 6179270 - 6179129
Alignment:
| Q |
179 |
tccgcgtcagaaacacacctcagggaaccacaaccactttaccgtcaagctccaaaccctccaaattagacttgttccttgaagcattcgacttgaattc |
278 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6179270 |
tccgcgtcagaaacacacctcaaggaaccagaaccactttaccgtcaagctccaaaccctccaaattagacttgttccttgaagcatccgacttgaattt |
6179171 |
T |
|
| Q |
279 |
gtcccttgaaataaaaagataggggtgccaaatcgctgcagc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6179170 |
gtcccttgaaataaaaagataggggtgccaaatcgctgcagc |
6179129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University