View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_21 (Length: 317)
Name: NF10498_low_21
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 12 - 303
Target Start/End: Complemental strand, 4578796 - 4578498
Alignment:
| Q |
12 |
agagagagtgtgcgtgtactttggtgtgtgnnnnnnngacaagattgtttcggac-------cccnnnnnnntgggaaaggtggtggcgtgtgcgacggt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
4578796 |
agagagagtgtgcgtgtactttggtgtgtgtttttttgacaagattgtttcggacattaaaacccaaaaaaatgggaaaggtggtggcgtgtgcgacggt |
4578697 |
T |
|
| Q |
105 |
gatcggagcaacggcggcgtgtgcagtggcgacggtgttgattcatcgttacgtgaagaaatcgaagcgatggggtaaagcaatagcgatattgaaggaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4578696 |
gatcggagcaacggcggcgtgtgcagtggcgacggtgttgattcatcgttacgtgaagaaatcgaagcgatggggtaaagcaatagcgatattgaaggaa |
4578597 |
T |
|
| Q |
205 |
tttgaagagaagtgtgcgacaccaacgttgaagctgaaacaggttgctgatgcaatgacggtggagatgcacgctggtcttgcttctgatggtggtagt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4578596 |
tttgaagagaagtgtgcgacaccaacgttgaagctgaaacaggttgctgatgcaatgacggtggagatgcacgctggtcttgcttctgatggtggtagt |
4578498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 252 - 300
Target Start/End: Original strand, 2039047 - 2039095
Alignment:
| Q |
252 |
tgatgcaatgacggtggagatgcacgctggtcttgcttctgatggtggt |
300 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
2039047 |
tgatgctatggcggtggagatgcacgctggtttagcttctgaaggtggt |
2039095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University