View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_38 (Length: 274)
Name: NF10498_low_38
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 34257438 - 34257680
Alignment:
| Q |
19 |
gcttgaccttgcaagtagattaacacactaagatgaatcctagttgcttaataaattttcaaaatttgatatcaatctacatgtttttgtatcaaacact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34257438 |
gcttgaccttgcaagtagattaacacactaagatgaatcctagttgcttaataaattttcaaaatttgatatcaatctccatgtttttgtatcaaacact |
34257537 |
T |
|
| Q |
119 |
tgaatgcaaagtgagttgattctatcctattataataggttgtcactaaataataactgaagcatcatcaataattttaataatgcaaacagtagcagta |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34257538 |
tgaatgcaaagtgaattgattctatcctattataataggttgtcactaaataataactgaagcatcatcaataattttaataatgcaaacagtagcagta |
34257637 |
T |
|
| Q |
219 |
aggtgcacaaaaaatcaacaacatattctcaattagcacaggt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34257638 |
aggtgcacaaaaaatcaacaacatattctcaattagcacaggt |
34257680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University