View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_45 (Length: 257)
Name: NF10498_low_45
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 25427979 - 25428044
Alignment:
| Q |
18 |
gtcgggatgggtgtggcgggagatctgaatctgcgtttggaagatgcaattgaaggcattgttggt |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25427979 |
gtcgggatgggtgtggcgggagatctgaatctgcgtttggaagatgcaattgaaggcattgttggt |
25428044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 173 - 246
Target Start/End: Original strand, 25428148 - 25428221
Alignment:
| Q |
173 |
gggatttgtagttggtgtgttaagcgggaaaacatgggcgcgttgatttcgttttcccgcgatagtcttttcat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
25428148 |
gggatttgtagttggtgtgttaagcgggaaaacatgggcgcgttgatttcgttttcccgcgatactgttttcat |
25428221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University