View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_52 (Length: 250)
Name: NF10498_low_52
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 39554075 - 39553836
Alignment:
| Q |
1 |
ctatgcaggcaacttggatgaaatgtggtggtttagtagtggcttgcacttttgaccatcgtatagctgatgcctattctgcaaacatgttccttgtatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39554075 |
ctatgcaggcaacttggatgaaatgtggtggtttagtagtggcttgcacttttgaccatcgtatagctgatgcctattctgcaaacatgttccttgtatc |
39553976 |
T |
 |
| Q |
101 |
atgggccgagatagctcggcccaatgataacaagtctttgatcccaacaacgcaaccttgttttcgacggtcacttctgaccccacgacgcccaccttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39553975 |
atgggccgagatagctcggcccaatgataacaagtctttgatcccaacaacgcaaccttgttttcgacggtcacttctgaccccacgacgcccaccttcc |
39553876 |
T |
 |
| Q |
201 |
atccatccttcaatttatgacatgtatgtccccatctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39553875 |
atccatccttcaatttatgacatgtatgtccccatctctg |
39553836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 39544056 - 39543817
Alignment:
| Q |
1 |
ctatgcaggcaacttggatgaaatgtggtggtttagtagtggcttgcacttttgaccatcgtatagctgatgcctattctgcaaacatgttccttgtatc |
100 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||| |
|
|
| T |
39544056 |
ctatgcagacaacatggatgaaatgtggtggattagtagtggcttgcacttttgaccatcgtatagcggacgcatattctgcaaacatgttccttgtatc |
39543957 |
T |
 |
| Q |
101 |
atgggccgagatagctcggcccaatgataacaagtctttgatcccaacaacgcaaccttgttttcgacggtcacttctgaccccacgacgcccaccttcc |
200 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39543956 |
atgggccgagatagctcgacccaacaataacaagtctttgatcccaacaatgcaaccttgttttagacggtcacttatgaccccacgacgcccaccttcc |
39543857 |
T |
 |
| Q |
201 |
atccatccttcaatttatgacatgtatgtccccatctctg |
240 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39543856 |
atacatccttcactttatgacatgtatgtccccatctctg |
39543817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 4 - 238
Target Start/End: Complemental strand, 39587182 - 39586948
Alignment:
| Q |
4 |
tgcaggcaacttggatgaaatgtggtggtttagtagtggcttgcacttttgaccatcgtatagctgatgcctattctgcaaacatgttccttgtatcatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||| ||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
39587182 |
tgcaggcaacttggatgaaatgtggtgggttagtagtggcgtgcaattttgaccatcgaatagccgacgcctattctgcaaacatgtttcttgtatcatg |
39587083 |
T |
 |
| Q |
104 |
ggccgagatagctcggcccaatgataacaagtctttgatcccaacaacgcaaccttgttttcgacggtcacttctgaccccacgacgcccaccttccatc |
203 |
Q |
| |
|
|||||||||||| || | | ||||||||||||||||||||||||| ||||||||||||| | |||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
39587082 |
ggccgagatagcccgatcgagcaataacaagtctttgatcccaacaacacaaccttgttttcaaaggtcccttctgaccccaagacacccaccttccatc |
39586983 |
T |
 |
| Q |
204 |
catccttcaatttatgacatgtatgtccccatctc |
238 |
Q |
| |
|
||||||||| | ||||||||||| |||||||||| |
|
|
| T |
39586982 |
catccttcactctatgacatgtacatccccatctc |
39586948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 17503893 - 17503782
Alignment:
| Q |
1 |
ctatgcaggcaacttggatgaaatgtggtggtttagtagtggcttgcacttttgaccatcgtatagctgatgcctattctgcaaacatgttccttgtatc |
100 |
Q |
| |
|
||||||||||||||| | || |||||||| |||||||||| ||||| ||||| ||||| ||||| ||||| ||||| ||||||||||||| ||||| |
|
|
| T |
17503893 |
ctatgcaggcaacttcattaaagtgtggtgggatagtagtggcatgcacatttgatcatcgcatagcagatgcatattcaacaaacatgttcctagtatc |
17503794 |
T |
 |
| Q |
101 |
atgggccgagat |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17503793 |
atgggccgagat |
17503782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 36 - 117
Target Start/End: Complemental strand, 17475735 - 17475654
Alignment:
| Q |
36 |
gtagtggcttgcacttttgaccatcgtatagctgatgcctattctgcaaacatgttccttgtatcatgggccgagatagctc |
117 |
Q |
| |
|
|||||||| ||||| ||||| ||||| ||||| |||||||| || ||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
17475735 |
gtagtggcatgcacatttgatcatcgcatagcagatgcctactcaacaaacatgttcttagtatcatgggccgagatggctc |
17475654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University