View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_63 (Length: 239)
Name: NF10498_low_63
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_63 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 24 - 239
Target Start/End: Original strand, 6178932 - 6179147
Alignment:
| Q |
24 |
gtgttatgaagttacttgcatataggtggacccatctggtagctgaaacagtggtagctagtttcatccagtttggggaggaaggtgtaaaaagagggga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6178932 |
gtgttatgaagttacttgcatataggtggacccatctggtagctgaaacagtggtagctagtttcatccagtttggggaggaaggtgtaaaaagagggga |
6179031 |
T |
|
| Q |
124 |
gggaggtatgaataggataatatacaaggctggttgtgagatgtatgtatggtagctagtttcacacagccagcgggccttccagttcagtccaattgct |
223 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6179032 |
gggaggtgtgaatacgataatatacaaggctggttgtgagatgtatgtatggtagctagtttcacacagccagcgggccttccagttcagtccaattgct |
6179131 |
T |
|
| Q |
224 |
gcagcgatttggcacc |
239 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6179132 |
gcagcgatttggcacc |
6179147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 6260560 - 6260612
Alignment:
| Q |
24 |
gtgttatgaagttacttgcatataggtggacccatctggtagctgaaacagtg |
76 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6260560 |
gtgttacgaagctacttgcatataggtggagccatctggtagctgaaacagtg |
6260612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University