View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10498_low_72 (Length: 222)

Name: NF10498_low_72
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10498_low_72
NF10498_low_72
[»] chr8 (1 HSPs)
chr8 (11-207)||(9721503-9721708)


Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 11 - 207
Target Start/End: Original strand, 9721503 - 9721708
Alignment:
11 gtgagatgaagtggtggagtttttgttcctgttctctctggtgaataatgcattggtggagggctcatgaataatggcaactttggtatctttttgccat 110  Q
    |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9721503 gtgatatgaagtggtggagtttttgttcctgatctctctggtgaataatgcattggtggagggctcatgaataatggcaactttggtatctttttgccat 9721602  T
111 tttcttcctcacaagcttccatcaatactctctttgtattcaatctaggtcttaggatttttggttacat---------aataatgtaatgtggcaatgt 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||    
9721603 tttcttcctcacaagcttccatcaatactctctttgtattcaatctaggtcttaggatttttggttacatatagtggaaaataatgtaatgtggcaatgt 9721702  T
202 tgaaga 207  Q
    ||||||    
9721703 tgaaga 9721708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University