View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_77 (Length: 208)
Name: NF10498_low_77
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 15 - 192
Target Start/End: Complemental strand, 37304383 - 37304206
Alignment:
| Q |
15 |
caaaggcccagacacatagggagggctcttaaatgttggacgtgaacagtagttaaagttggtcgagtcctagttaatggatcatgtatggtatgaatag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304383 |
caaaggcccagacacatagggagggctcttaaatgttggacgtgaacagtagttaaagttggtcgagtcctagttaatggatcatgtatggtatgaatag |
37304284 |
T |
 |
| Q |
115 |
tcccccaaagacagagtccacactgacaaagtcaccaaacagcattcatactccggccacttgaattaggttaccatc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304283 |
tcccccaaagacagagtccacactgacaaagtcaccaaacagcattcatactccggccacttgaattaggttaccatc |
37304206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University