View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10498_low_8 (Length: 413)
Name: NF10498_low_8
Description: NF10498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10498_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 39 - 348
Target Start/End: Complemental strand, 25817243 - 25816947
Alignment:
| Q |
39 |
tgcagttcctacatttagtttaaatgtgagtaggatagaaaaaatgtaacctttgaggttgataagggtaatgagcgacttctgatcattttcaggcgaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25817243 |
tgcagttcctacatttagtttaaatgtgagtaggagagaaaaaatgtaacctttgaggttgatgagggtaatgagcgacttctgattattttcaggcgaa |
25817144 |
T |
|
| Q |
139 |
ccgaattcgcatcaaaatgagggatcattccataagatcttatgcatggtatatgtaggaaacatgaatgtagagaattatattctaatgatcaaggcat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
25817143 |
ccgaattcgcatcaaaatgagggatcattccataagatcttatgcatggt-----------------atgcacagaattatattctaatgatcaaggcat |
25817061 |
T |
|
| Q |
239 |
gatccattgttttaggtc----atatataggttcaaattccattgtttatggaatgatatttgacattgtccgtcagtttacacggttttatacggtcat |
334 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25817060 |
gatccattcttttaggtcatatatatataggttcagattccattgtttttggaatgatatttgacattgtccgtcagtttacacggttttatacggtcat |
25816961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 25817299 - 25817266
Alignment:
| Q |
1 |
tgggctaccttagtcggtaaagatcaaggaagaa |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25817299 |
tgggctaccttagtcggtaaagatcaaggaagaa |
25817266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 70
Target Start/End: Original strand, 12010464 - 12010497
Alignment:
| Q |
37 |
actgcagttcctacatttagtttaaatgtgagta |
70 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
12010464 |
actgcagttcctacatttagttcaaatgtgagta |
12010497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University