View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10499_low_22 (Length: 249)
Name: NF10499_low_22
Description: NF10499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10499_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 128 - 235
Target Start/End: Complemental strand, 48533752 - 48533645
Alignment:
| Q |
128 |
acaagtttactctagagttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48533752 |
acaagtttactctagagttgccagatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg |
48533653 |
T |
|
| Q |
228 |
agtgagtt |
235 |
Q |
| |
|
|||||||| |
|
|
| T |
48533652 |
agtgagtt |
48533645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 45 - 209
Target Start/End: Complemental strand, 48536811 - 48536647
Alignment:
| Q |
45 |
gatcacaaaccaaacaatgtctccgtcgcaagctgcaggaacacgtcgtggctcaacatggactatcaatattaaaattgaacacaagtttactctagag |
144 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||| | |||||||| | |||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
48536811 |
gatcataaaccaaacaatgtctgcgtcccaagctgcaggaacagggggtggctcagcgctgactatcaatatcaaagttgaacacaagtttacggtagag |
48536712 |
T |
|
| Q |
145 |
ttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgagga |
209 |
Q |
| |
|
||| |||||| || ||||| ||||||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
48536711 |
ttggcggatctggtgaccgttgtcgctgcagattcgacgaaagcgccgagcatcgatgttgagga |
48536647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 11 - 61
Target Start/End: Complemental strand, 48533799 - 48533749
Alignment:
| Q |
11 |
atgaatgaatcttgacgcaaacaaaccctgttttgatcacaaaccaaacaa |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48533799 |
atgaatgaatcttgacgcaaacaaaccctgttttgatcacaaaccaaacaa |
48533749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University