View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10499_low_27 (Length: 241)
Name: NF10499_low_27
Description: NF10499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10499_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 103 - 231
Target Start/End: Complemental strand, 19146798 - 19146668
Alignment:
| Q |
103 |
gtttgactcgaactcagcaactataaacatgcaagtacacgaatcatgacaaaatgttcagataacaatttataagcatatatatacttatccaaactaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19146798 |
gtttgactcgaactcagcaactataaacatgcaagtacacgaatcatgacaaaatgttcagataacaatttataagca----tatacttatccaaactaa |
19146703 |
T |
|
| Q |
203 |
tgccac------ccaatagtaatagtaaacctttg |
231 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |
|
|
| T |
19146702 |
tgccacccaatgccaatagtaatagtaaacctttg |
19146668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University