View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10499_low_27 (Length: 241)

Name: NF10499_low_27
Description: NF10499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10499_low_27
NF10499_low_27
[»] chr2 (1 HSPs)
chr2 (103-231)||(19146668-19146798)


Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 103 - 231
Target Start/End: Complemental strand, 19146798 - 19146668
Alignment:
103 gtttgactcgaactcagcaactataaacatgcaagtacacgaatcatgacaaaatgttcagataacaatttataagcatatatatacttatccaaactaa 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||    
19146798 gtttgactcgaactcagcaactataaacatgcaagtacacgaatcatgacaaaatgttcagataacaatttataagca----tatacttatccaaactaa 19146703  T
203 tgccac------ccaatagtaatagtaaacctttg 231  Q
    ||||||      |||||||||||||||||||||||    
19146702 tgccacccaatgccaatagtaatagtaaacctttg 19146668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University