View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10499_low_30 (Length: 239)
Name: NF10499_low_30
Description: NF10499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10499_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42271891 - 42271669
Alignment:
| Q |
1 |
aatctctcatcatcggtgaaagaaacccatgatggtgtgatacggttaccttggtcgttggctatgatttcaacatgaccgttcctgtaaacaccaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42271891 |
aatctctcatcatcggtgaaagaaacccatgatggtgtgatacggttaccttggtcgttggctatgatttcaacatgaccgttcttgtaaacaccaacac |
42271792 |
T |
|
| Q |
101 |
atgaatatgttgttccaagatctatcccaataacagtccctaacttggttgcttcctcttttgcattggaacatgcaaatagacatcctgtggaaatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42271791 |
atgaatatgttgttccaagatctatcccaataacagtccctaacttggttgcttcctcttttgcattggaacatgcaaatagacatcctgtggaaatttt |
42271692 |
T |
|
| Q |
201 |
ttaaatattagttacatcattac |
223 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
42271691 |
ttaaatattagttacattattac |
42271669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 42324035 - 42323868
Alignment:
| Q |
1 |
aatctctcatcatcggtgaaagaaacccatgatggtgtgatacggttaccttggtcgttggctatgatttcaacatgaccgttcctgtaaacaccaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| || ||| ||||||||||||||| |
|
|
| T |
42324035 |
aatctctcatcatcggtgaaagaaacccatgatggtgtgatacgatttccttggtcgttggctatgatttcaacatggccattcttgtaaacaccaacac |
42323936 |
T |
|
| Q |
101 |
atgaatatgttgttccaagatctatcccaataacagtccctaacttggttg---cttcctcttttgca |
165 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
42323935 |
atgaataggttgttccaagatctatcccaataacagtccctaacttggtggtcccttcctcttttgca |
42323868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 75
Target Start/End: Original strand, 39987032 - 39987066
Alignment:
| Q |
41 |
tacggttaccttggtcgttggctatgatttcaaca |
75 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
39987032 |
tacggttaccttggtcgttggcgatgatttcaaca |
39987066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University