View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10499_low_32 (Length: 230)
Name: NF10499_low_32
Description: NF10499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10499_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 11 - 87
Target Start/End: Complemental strand, 12842387 - 12842311
Alignment:
| Q |
11 |
ggacatggagggaccgattgcctctatttgaatgcacctaattctgtcactatttggataaatacgacgaaatgata |
87 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
12842387 |
ggacatggagggaccgattgcctatatttgaatgcacctaattctgtcactattgggataaatacaacgaaatgata |
12842311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 100 - 170
Target Start/End: Complemental strand, 12842100 - 12842030
Alignment:
| Q |
100 |
ttttcttaaatagaagatggtctattatcaataaatgaaatgaaaaatcctatctatctcataatcagaga |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
12842100 |
ttttcttaaatagaagatggtctattatcaataaatgaagtgaaaaatcatatctatctcataatcagaga |
12842030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 91 - 170
Target Start/End: Complemental strand, 12841065 - 12840979
Alignment:
| Q |
91 |
tctagttgattttcttaaatagaagatggtctattatc-------aataaatgaaatgaaaaatcctatctatctcataatcagaga |
170 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12841065 |
tctagttgattttcttaagtagaagatggtctattatctgtaagtaataaatgaaatgaaaaatcctatctatctcataatcagaga |
12840979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 85
Target Start/End: Original strand, 12863081 - 12863131
Alignment:
| Q |
35 |
tatttgaatgcacctaattctgtcactatttggataaatacgacgaaatga |
85 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
12863081 |
tatttgaatgcacctaattctgtcactgtttggataaatacaacgagatga |
12863131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 170
Target Start/End: Original strand, 12863198 - 12863239
Alignment:
| Q |
129 |
aataaatgaaatgaaaaatcctatctatctcataatcagaga |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12863198 |
aataaatgaaatgaaaaatcctatctgtctcataatcagaga |
12863239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University