View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10500_low_19 (Length: 343)

Name: NF10500_low_19
Description: NF10500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10500_low_19
NF10500_low_19
[»] chr4 (26 HSPs)
chr4 (1-338)||(15227529-15227866)
chr4 (1-338)||(1899916-1900253)
chr4 (2-336)||(15285204-15285538)
chr4 (6-338)||(14235808-14236140)
chr4 (8-337)||(14664675-14665004)
chr4 (33-337)||(17013657-17013961)
chr4 (1-151)||(24460880-24461030)
chr4 (6-338)||(15391615-15391948)
chr4 (8-337)||(24592596-24592925)
chr4 (32-337)||(14763613-14763918)
chr4 (32-337)||(36344821-36345126)
chr4 (33-277)||(6569570-6569814)
chr4 (53-277)||(19372978-19373202)
chr4 (33-254)||(31126828-31127049)
chr4 (32-277)||(54833107-54833352)
chr4 (33-277)||(14098258-14098502)
chr4 (33-254)||(27163627-27163848)
chr4 (33-247)||(5005617-5005831)
chr4 (33-254)||(30753482-30753703)
chr4 (33-277)||(18800932-18801176)
chr4 (33-277)||(33674120-33674364)
chr4 (33-254)||(40105948-40106169)
chr4 (33-254)||(21969441-21969662)
chr4 (32-176)||(24112483-24112627)
chr4 (32-176)||(34189266-34189410)
chr4 (33-277)||(39850340-39850584)
[»] scaffold0124 (2 HSPs)
scaffold0124 (7-338)||(20053-20384)
scaffold0124 (8-337)||(30095-30424)
[»] chr2 (42 HSPs)
chr2 (1-338)||(21703428-21703765)
chr2 (1-338)||(19456685-19457022)
chr2 (33-326)||(27434743-27435036)
chr2 (7-338)||(27392630-27392961)
chr2 (8-337)||(23128840-23129169)
chr2 (1-151)||(27118515-27118665)
chr2 (8-337)||(28881852-28882181)
chr2 (1-151)||(3784481-3784631)
chr2 (1-151)||(31891592-31891742)
chr2 (1-151)||(34156838-34156988)
chr2 (1-151)||(16163426-16163576)
chr2 (1-151)||(34303567-34303717)
chr2 (8-337)||(20837556-20837885)
chr2 (8-337)||(12655180-12655509)
chr2 (45-337)||(37374799-37375091)
chr2 (33-277)||(13936843-13937087)
chr2 (33-253)||(21677481-21677701)
chr2 (33-277)||(34279147-34279391)
chr2 (33-277)||(37925191-37925435)
chr2 (33-277)||(261064-261308)
chr2 (39-254)||(12716910-12717125)
chr2 (33-247)||(11635488-11635702)
chr2 (33-247)||(11641677-11641891)
chr2 (8-277)||(34286052-34286321)
chr2 (8-277)||(34291112-34291381)
chr2 (33-254)||(16829637-16829858)
chr2 (33-254)||(16891623-16891844)
chr2 (33-254)||(31876002-31876223)
chr2 (33-254)||(34861401-34861622)
chr2 (33-254)||(37686208-37686429)
chr2 (33-254)||(37701473-37701694)
chr2 (33-254)||(39889783-39890004)
chr2 (33-277)||(40233197-40233441)
chr2 (33-277)||(19416798-19417042)
chr2 (33-253)||(22926327-22926547)
chr2 (147-277)||(12586499-12586629)
chr2 (33-247)||(32049526-32049740)
chr2 (147-277)||(9350407-9350537)
chr2 (147-277)||(27776905-27777035)
chr2 (147-277)||(27803390-27803520)
chr2 (147-277)||(27816672-27816802)
chr2 (39-277)||(39052133-39052371)
[»] chr7 (30 HSPs)
chr7 (1-326)||(16040980-16041305)
chr7 (1-338)||(16450159-16450496)
chr7 (33-337)||(16518612-16518916)
chr7 (33-337)||(16503576-16503880)
chr7 (1-151)||(31088625-31088775)
chr7 (1-151)||(45733292-45733442)
chr7 (33-337)||(2154216-2154520)
chr7 (8-277)||(10917036-10917305)
chr7 (33-337)||(5127635-5127939)
chr7 (8-337)||(11424947-11425276)
chr7 (33-277)||(16736656-16736900)
chr7 (33-277)||(16751710-16751954)
chr7 (33-277)||(17523235-17523479)
chr7 (33-277)||(17529736-17529980)
chr7 (33-277)||(5147536-5147780)
chr7 (33-277)||(45387046-45387290)
chr7 (32-253)||(4145318-4145539)
chr7 (33-277)||(31124614-31124858)
chr7 (33-254)||(26275290-26275511)
chr7 (33-277)||(9618354-9618598)
chr7 (33-277)||(11441263-11441507)
chr7 (33-277)||(24592737-24592981)
chr7 (33-252)||(26320065-26320284)
chr7 (33-223)||(26435014-26435204)
chr7 (33-254)||(3445020-3445241)
chr7 (33-254)||(26485940-26486161)
chr7 (32-176)||(5159326-5159470)
chr7 (33-254)||(31564595-31564816)
chr7 (33-277)||(26538069-26538313)
chr7 (33-277)||(26670110-26670354)
[»] chr3 (59 HSPs)
chr3 (1-338)||(16626822-16627158)
chr3 (1-338)||(18529999-18530336)
chr3 (33-326)||(15893057-15893350)
chr3 (33-337)||(8301615-8301919)
chr3 (8-337)||(8295578-8295907)
chr3 (8-337)||(18050865-18051194)
chr3 (1-151)||(17994100-17994250)
chr3 (33-337)||(4797004-4797308)
chr3 (33-337)||(15741433-15741737)
chr3 (1-151)||(4625736-4625886)
chr3 (1-151)||(5652179-5652329)
chr3 (8-337)||(35880369-35880698)
chr3 (8-337)||(29149081-29149410)
chr3 (33-337)||(4721234-4721538)
chr3 (8-279)||(18330335-18330601)
chr3 (32-277)||(8211404-8211649)
chr3 (33-337)||(6191919-6192223)
chr3 (32-337)||(18277402-18277707)
chr3 (32-337)||(18292703-18293008)
chr3 (32-337)||(18308004-18308309)
chr3 (21-277)||(5596705-5596961)
chr3 (32-247)||(20065739-20065954)
chr3 (32-253)||(5466672-5466893)
chr3 (33-337)||(28116308-28116612)
chr3 (33-151)||(5713016-5713134)
chr3 (33-151)||(5723926-5724044)
chr3 (33-151)||(5757433-5757551)
chr3 (33-151)||(5768324-5768442)
chr3 (32-326)||(10395750-10396044)
chr3 (33-277)||(7072875-7073119)
chr3 (33-277)||(22871225-22871469)
chr3 (33-277)||(22886284-22886528)
chr3 (32-254)||(28020964-28021186)
chr3 (33-254)||(17985307-17985528)
chr3 (33-254)||(18224877-18225098)
chr3 (33-277)||(47023116-47023360)
chr3 (32-254)||(4347034-4347256)
chr3 (33-254)||(6542825-6543046)
chr3 (33-223)||(29665336-29665526)
chr3 (33-254)||(5013398-5013619)
chr3 (48-277)||(21674356-21674585)
chr3 (33-277)||(7996225-7996469)
chr3 (33-277)||(10642733-10642977)
chr3 (33-277)||(36997440-36997684)
chr3 (33-277)||(11110712-11110956)
chr3 (33-277)||(18242390-18242634)
chr3 (32-176)||(22387925-22388069)
chr3 (33-277)||(24327822-24328066)
chr3 (33-253)||(28338989-28339209)
chr3 (33-253)||(31964824-31965044)
chr3 (33-253)||(50134422-50134642)
chr3 (33-277)||(51781674-51781918)
chr3 (147-277)||(20577327-20577457)
chr3 (33-253)||(4416603-4416823)
chr3 (32-176)||(4892977-4893121)
chr3 (32-326)||(32438771-32439065)
chr3 (33-250)||(5609673-5609890)
chr3 (33-277)||(51796762-51797007)
chr3 (33-277)||(48465578-48465822)
[»] chr1 (7 HSPs)
chr1 (7-338)||(20460748-20461079)
chr1 (1-338)||(16208303-16208640)
chr1 (1-151)||(20340610-20340760)
chr1 (33-254)||(41793618-41793839)
chr1 (33-277)||(10962371-10962615)
chr1 (33-277)||(51637919-51638163)
chr1 (33-277)||(28584682-28584926)
[»] chr5 (51 HSPs)
chr5 (1-338)||(25198682-25199019)
chr5 (3-339)||(23891855-23892191)
chr5 (1-174)||(22888287-22888460)
chr5 (35-337)||(24688366-24688668)
chr5 (8-337)||(30934287-30934616)
chr5 (1-151)||(13184820-13184970)
chr5 (1-151)||(13440666-13440816)
chr5 (1-151)||(33877087-33877237)
chr5 (8-337)||(23752632-23752961)
chr5 (1-151)||(11325634-11325784)
chr5 (8-337)||(23718170-23718500)
chr5 (143-337)||(24951761-24951955)
chr5 (8-337)||(11549005-11549334)
chr5 (8-337)||(33777138-33777467)
chr5 (8-280)||(22999296-22999568)
chr5 (33-277)||(9548750-9548994)
chr5 (33-277)||(30168180-30168424)
chr5 (33-337)||(41674360-41674664)
chr5 (33-337)||(15658967-15659271)
chr5 (33-277)||(31431139-31431383)
chr5 (63-277)||(2510762-2510976)
chr5 (33-254)||(18375619-18375840)
chr5 (33-134)||(24969878-24969979)
chr5 (33-277)||(3789237-3789481)
chr5 (33-253)||(8665682-8665902)
chr5 (33-277)||(9317162-9317406)
chr5 (39-254)||(24681171-24681386)
chr5 (39-254)||(24723698-24723913)
chr5 (33-254)||(12131889-12132110)
chr5 (21-254)||(32599664-32599897)
chr5 (33-254)||(33516090-33516311)
chr5 (33-254)||(37671699-37671920)
chr5 (33-254)||(37771206-37771427)
chr5 (33-277)||(6874013-6874257)
chr5 (33-325)||(37358862-37359154)
chr5 (147-277)||(40473873-40474003)
chr5 (33-254)||(30151752-30151973)
chr5 (33-254)||(31826626-31826847)
chr5 (32-277)||(34616232-34616477)
chr5 (33-277)||(5637621-5637865)
chr5 (33-277)||(15759064-15759308)
chr5 (33-277)||(18500955-18501199)
chr5 (33-277)||(26480103-26480347)
chr5 (33-277)||(43077960-43078204)
chr5 (33-277)||(37754679-37754923)
chr5 (33-254)||(28960005-28960226)
chr5 (33-277)||(13325051-13325295)
chr5 (33-277)||(28648937-28649181)
chr5 (33-277)||(29967273-29967517)
chr5 (33-277)||(30029126-30029370)
chr5 (32-176)||(33292340-33292484)
[»] chr8 (22 HSPs)
chr8 (33-337)||(16283091-16283395)
chr8 (8-337)||(16277196-16277525)
chr8 (33-337)||(19687740-19688044)
chr8 (6-338)||(22081114-22081446)
chr8 (1-151)||(9354453-9354603)
chr8 (9-151)||(19659281-19659423)
chr8 (8-337)||(14557269-14557598)
chr8 (1-151)||(44562932-44563082)
chr8 (8-337)||(2137503-2137832)
chr8 (8-337)||(27609149-27609478)
chr8 (8-337)||(18710228-18710557)
chr8 (33-337)||(19674080-19674384)
chr8 (33-277)||(31490019-31490263)
chr8 (32-277)||(19286167-19286412)
chr8 (32-253)||(31354250-31354471)
chr8 (33-254)||(19208629-19208850)
chr8 (33-277)||(3329788-3330032)
chr8 (33-277)||(28362224-28362468)
chr8 (33-277)||(29829015-29829259)
chr8 (33-277)||(19518412-19518656)
chr8 (33-277)||(33258425-33258669)
chr8 (33-337)||(12093002-12093306)
[»] scaffold0089 (3 HSPs)
scaffold0089 (33-337)||(29405-29709)
scaffold0089 (33-337)||(40379-40683)
scaffold0089 (8-337)||(47270-47599)
[»] scaffold0109 (1 HSPs)
scaffold0109 (7-338)||(21208-21539)
[»] chr6 (41 HSPs)
chr6 (33-337)||(22935130-22935434)
chr6 (33-337)||(23857575-23857879)
chr6 (8-337)||(13299179-13299508)
chr6 (3-180)||(22477496-22477673)
chr6 (1-338)||(20160345-20160679)
chr6 (1-338)||(22172152-22172486)
chr6 (8-337)||(15424545-15424874)
chr6 (1-151)||(13522291-13522441)
chr6 (1-151)||(33374474-33374624)
chr6 (8-337)||(26988640-26988969)
chr6 (8-280)||(24304846-24305118)
chr6 (33-337)||(24863356-24863660)
chr6 (33-337)||(26999712-27000016)
chr6 (1-151)||(8892528-8892678)
chr6 (1-151)||(8903763-8903913)
chr6 (1-151)||(28162485-28162635)
chr6 (8-337)||(16749493-16749822)
chr6 (33-280)||(26918076-26918323)
chr6 (32-277)||(29549177-29549422)
chr6 (32-277)||(27044089-27044334)
chr6 (32-254)||(4525011-4525233)
chr6 (21-277)||(29501105-29501361)
chr6 (33-254)||(30558269-30558490)
chr6 (33-277)||(17024961-17025205)
chr6 (33-254)||(4757483-4757704)
chr6 (33-254)||(29572735-29572956)
chr6 (33-277)||(3695762-3696006)
chr6 (33-277)||(4772696-4772940)
chr6 (33-277)||(27007411-27007655)
chr6 (33-277)||(27484816-27485060)
chr6 (33-337)||(4546037-4546341)
chr6 (33-277)||(16944280-16944524)
chr6 (33-253)||(26777880-26778100)
chr6 (33-337)||(28207081-28207385)
chr6 (33-254)||(27360263-27360484)
chr6 (33-254)||(27450606-27450827)
chr6 (33-325)||(27629962-27630254)
chr6 (33-277)||(34463614-34463858)
chr6 (33-254)||(4724396-4724617)
chr6 (33-277)||(16673826-16674070)
chr6 (33-254)||(26116672-26116893)
[»] scaffold0143 (1 HSPs)
scaffold0143 (8-337)||(26934-27263)
[»] scaffold0260 (1 HSPs)
scaffold0260 (1-151)||(2933-3083)
[»] scaffold0029 (1 HSPs)
scaffold0029 (33-337)||(440-744)
[»] scaffold0336 (1 HSPs)
scaffold0336 (32-277)||(7934-8179)
[»] scaffold0237 (1 HSPs)
scaffold0237 (33-254)||(15240-15461)
[»] scaffold0350 (1 HSPs)
scaffold0350 (33-254)||(7549-7770)
[»] scaffold0099 (1 HSPs)
scaffold0099 (143-337)||(48568-48769)
[»] scaffold0144 (1 HSPs)
scaffold0144 (33-277)||(26512-26756)
[»] scaffold0038 (1 HSPs)
scaffold0038 (33-337)||(7579-7883)
[»] scaffold0159 (1 HSPs)
scaffold0159 (33-250)||(9376-9593)
[»] scaffold0415 (1 HSPs)
scaffold0415 (147-277)||(5691-5821)
[»] scaffold0496 (1 HSPs)
scaffold0496 (33-187)||(43-197)


Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 26)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 15227866 - 15227529
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15227866 ctggtggctgttgttgcatttgctgaacgacagcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 15227767  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
15227766 atgctgagagtattgcgcatacgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatc 15227667  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||    
15227666 cctacttctgtttctttcttcttatgatgaccgttaccatgcctctttgatgcatttgcggaggattcatctttctcgaatacaataatgccttctctga 15227567  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     ||||||||||||||||||||||||| || ||||||||    
15227566 cagcttcttctagacgagtccccatggtgaccatctca 15227529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 1900253 - 1899916
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
1900253 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 1900154  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||||||||||||| ||||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1900153 atgctgagagtatggcgcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 1900054  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||| ||||| ||||||||||||||||    
1900053 cctacttctgtttctttcttcttatgatgatcgttaccgtacctctttgatgcatttacagaggattcaactttctcaaatacaataatgccttctctga 1899954  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     ||||||||| | ||||||||||||| || ||||||||    
1899953 cagcttcttccaaacgagtccccatggtgaccatctca 1899916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 2 - 336
Target Start/End: Original strand, 15285204 - 15285538
Alignment:
2 tggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggga 101  Q
    ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| | |||||| ||||||||||||||||||||||| |||    
15285204 tggtggctgttgttgcatttgctgaacgatggcattaacgggcacctgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaagga 15285303  T
102 tgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatcc 201  Q
    |||||||||||||||||||| |||||| | |||  ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
15285304 tgctgagagtattgcgcatatgggtacaatggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatcc 15285403  T
202 ctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgat 301  Q
     |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||     
15285404 atacttctgtttctttcttcttatgatgaccgttaccgttcctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgac 15285503  T
302 agcttcttctagacgagtccccatgatgtccatct 336  Q
    |||||||||||| |||||||||||| || ||||||    
15285504 agcttcttctaggcgagtccccatggtgaccatct 15285538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 6 - 338
Target Start/End: Original strand, 14235808 - 14236140
Alignment:
6 ggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgct 105  Q
    ||||||||||||||||||||| | | |||||||||||||||||  || ||||||||||| | ||| || ||||||||||||||||| ||||| |||||||    
14235808 ggctgttgttgcatttgctgagcaatggcattaacgggtacctatgggtgacccgatggtagagggtactgatgatagaatggtgggaagaaaggatgct 14235907  T
106 gagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctac 205  Q
    |||||||||||  |||| |||||| | ||  |||||| |||||||||||||||| |||||| ||||||||||||| || |||||||||||||||||||||    
14235908 gagagtattgcatatactggtacggcagaggtaactgagcagcattaataggggtaacagtggccatggattgactggttccggcagataccatccctac 14236007  T
206 ttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagct 305  Q
    |||||| |||||||||||||||||||| ||||||||| |||||||||   |||| ||||||||  |||||||||| || |||||| ||||||||| |||     
14236008 ttctgtctctttcttcttatgatgaccattaccgtacttctttgatgtgcttgcagaggattcccctttctcgaacacaataatgtcttctctgacagcc 14236107  T
306 tcttctagacgagtccccatgatgtccatctca 338  Q
    |||||||  || || |||||| || ||||||||    
14236108 tcttctaagcgggttcccatggtgaccatctca 14236140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 14665004 - 14664675
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
14665004 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 14664905  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  | ||||| ||||| ||||||   |  ||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||    
14664904 gaatacggtgcatatgggtatgacggaggcatttgggcagcattgataggagcaacagtagccatggattgaccagctccggcagacaccatccctactt 14664805  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| || |  |||||    
14664804 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctaacggcttc 14664705  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || |||||||| |||||| || |||||||    
14664704 ctccagacgagttcccatggtgaccatctc 14664675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 17013961 - 17013657
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| || |    
17013961 gcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgaag 17013862  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| ||||||||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||| || || ||    
17013861 gaggcatttgggctgcattgataggagcaacagtagccatggattgaccagctccggctgacaccatccctacttccgtttctttcttcttgtggtgtcc 17013762  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  ||||| || ||||| || |||||| || ||    
17013761 attaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgacc 17013662  T
333 atctc 337  Q
    |||||    
17013661 atctc 17013657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 24460880 - 24461030
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||    
24460880 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaaggg 24460979  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
24460980 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 24461030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 6 - 338
Target Start/End: Original strand, 15391615 - 15391948
Alignment:
6 ggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccg---atggcaaaggatattgatgatagaatggtggaaagaagggat 102  Q
    |||||||| |||||||||||| | | |||||| | ||||||||||||||||||||   |||||   ||||| || ||||| |||||||| ||||| ||||    
15391615 ggctgttgctgcatttgctgagcaatggcattgatgggtacctgaggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggat 15391711  T
103 gctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaa-cagtagccatggattgaccggctccggcagataccatcc 201  Q
    ||||||||||||||   ||| | |||| ||||  || ||| ||| |||| || ||||||| |||||||||||||||||| || ||| |||||||||||||    
15391712 gctgagagtattgcatgtactgatacggcggaggtagctgagcaacattgatgggggcaaacagtagccatggattgactggttccagcagataccatcc 15391811  T
202 ctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgat 301  Q
    |||||||||| |||||||||||||||||||| || || ||| || ||||||||||||| ||||||||| ||||| | || || |||||||| |||||||     
15391812 ctacttctgtctctttcttcttatgatgaccattgccatacttccttgatgcatttgcagaggattcacctttcccaaacacaataatgccatctctgac 15391911  T
302 agcttcttctagacgagtccccatgatgtccatctca 338  Q
    ||| |||||||  || || |||||| || ||||||||    
15391912 agcctcttctaagcgggttcccatggtgaccatctca 15391948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 24592596 - 24592925
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
24592596 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 24592695  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||    
24592696 gaatacggcacatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctattt 24592795  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
24592796 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 24592895  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| ||||| || |||||| || |||||||    
24592896 ttccagacgggttcccatggtgaccatctc 24592925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 32 - 337
Target Start/End: Original strand, 14763613 - 14763918
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| |||    
14763613 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgac 14763712  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
14763713 ggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 14763812  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtc 331  Q
    | ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || |    
14763813 cattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgac 14763912  T
332 catctc 337  Q
    ||||||    
14763913 catctc 14763918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 32 - 337
Target Start/End: Original strand, 36344821 - 36345126
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| |||||||||||| |||||||| || ||| | ||||| ||||||||||||||  || |||| ||||| |||    
36344821 ggcattgacaggaacctgaggttggcccggtggcaaaggatactgatgataaaacggtaggaagaacggatgctgagagtacggcacatatgggtatgac 36344920  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
36344921 ggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 36345020  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtc 331  Q
    | ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || |    
36345021 cattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgac 36345120  T
332 catctc 337  Q
    ||||||    
36345121 catctc 36345126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 6569814 - 6569570
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||| ||| || ||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
6569814 gcattaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 6569715  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
6569714 gaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 6569615  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||||| || ||||||||| |||||||    
6569614 attaccatatctcttcgatgcattcgcagaggattcagctttctc 6569570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 53 - 277
Target Start/End: Complemental strand, 19373202 - 19372978
Alignment:
53 ttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatta 152  Q
    |||||||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| ||||||   |  || || |||||     
19373202 ttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgagctgcattg 19373103  T
153 ataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatg 252  Q
    ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||    
19373102 ataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatg 19373003  T
253 catttgcggaggattcaactttctc 277  Q
    ||||  | ||||||||| |||||||    
19373002 cattcacagaggattcagctttctc 19372978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 31126828 - 31127049
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
31126828 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 31126927  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
31126928 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 31127027  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
31127028 attaccatacctcttcgatgca 31127049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 32 - 277
Target Start/End: Complemental strand, 54833352 - 54833107
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||| ||||| || |||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| |||    
54833352 ggcattgacaggaacctgaggttggcccggtggtaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgac 54833253  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || || ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
54833252 ggaggcatttgagctgcattgataggagcaacagtggccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtc 54833153  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | ||||| |||||||| || ||| | || || |||||| |||||||    
54833152 cattaccatacctcttcgacgcactcgcagaagattcagctttctc 54833107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 14098502 - 14098258
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
14098502 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 14098403  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
14098402 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 14098303  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||| | ||||||||| |||||||    
14098302 attaccatatctcttcgacgcatttacagaggattcagctttctc 14098258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 27163627 - 27163848
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
27163627 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 27163726  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
27163727 gaggcatttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtcc 27163826  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
27163827 attaccgtaccttttcgatgca 27163848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 247
Target Start/End: Complemental strand, 5005831 - 5005617
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
5005831 gcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 5005732  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
5005731 gaggcatttgagctgcattgatgggagcaacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtcc 5005632  T
233 gttaccgtacctctt 247  Q
     ||||| ||||||||    
5005631 attaccatacctctt 5005617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 30753703 - 30753482
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || |||||||||||||  |||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
30753703 gcattgacgggcacttgaggttgacccggcggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 30753604  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || | |||||| ||||| |||||||||||||| || || ||    
30753603 gaggcatttgagctgcattgataggtgcaacagtagccatggattgaccggctccagctgacatcatccccacttccgtttctttcttcttgtggtgtcc 30753504  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
30753503 attaccatacctcttcgatgca 30753482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 18800932 - 18801176
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
18800932 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 18801031  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| | |||||||||||| || || |||||||| |||||||||||||||||||| || || ||    
18801032 gaggcatttgagctgcattgataggtgcaacagtagccatagcttgaccggctccagctgacaccatccccacttctgtttctttcttcttgtggtgtcc 18801131  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
18801132 attaccatatctcttcgacgcattcacagaggattcagctttctc 18801176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 33674120 - 33674364
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || |||||||||||||  ||||  || || ||||| || |||||||| ||||| ||||||||||||||  ||   || ||||| ||||    
33674120 gcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaatggtgggaagaacggatgctgagagtacggcatgtatgggtatgacg 33674219  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
33674220 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 33674319  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||| | ||||||||| |||||||    
33674320 attaccatatctcttcgacgcatttacagaggattcagctttctc 33674364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 40105948 - 40106169
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
40105948 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 40106047  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |     
40106048 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtct 40106147  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
40106148 attaccgtaccttttcgatgca 40106169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 21969662 - 21969441
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| || || || ||||| ||||||||||| ||  ||  ||| ||||| | ||    
21969662 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggcgggaagaaaggatgctgagaatacggcatatatgggtatggcg 21969563  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||| ||||| || || ||    
21969562 gaggcatttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttcttttttcttgtggtgtcc 21969463  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
21969462 attaccatacctcttcgatgca 21969441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 32 - 176
Target Start/End: Complemental strand, 24112627 - 24112483
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  | ||||| ||||| |||    
24112627 ggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggtaggac 24112528  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggat 176  Q
    ||    ||||| |||||||| | ||| |||||||||||| |||||    
24112527 gggggaaactgagcagcattgacaggagcaacagtagccttggat 24112483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 32 - 176
Target Start/End: Original strand, 34189266 - 34189410
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  | ||||| ||||| |||    
34189266 ggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggtaggac 34189365  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggat 176  Q
    ||    ||||| |||||||| ||||| || ||||||||| |||||    
34189366 gggggaaactgagcagcattgataggagcgacagtagccttggat 34189410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 39850584 - 39850340
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || |||||||||||||  ||||  || || ||||| || || ||||| ||||| ||||||||||||||  ||   || ||||| ||||    
39850584 gcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggtatgacg 39850485  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||||||||||||| || || ||    
39850484 gaggcatttgagctgcattgataggtgcaacagtagccattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 39850385  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || | |||  | ||||||||| |||||||    
39850384 attaccatatctcttcgacgtattcacagaggattcagctttctc 39850340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: scaffold0124
Description:

Target: scaffold0124; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 7 - 338
Target Start/End: Complemental strand, 20384 - 20053
Alignment:
7 gctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||    
20384 gctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatgatggaaagaagggatgctg 20285  T
107 agagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctact 206  Q
    ||||||| ||||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20284 agagtatggcgcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctact 20185  T
207 tctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagctt 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||    
20184 tctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaacacaataatgccttctctgacagctt 20085  T
307 cttctagacgagtccccatgatgtccatctca 338  Q
    ||||||| |||||||||||| || ||||||||    
20084 cttctaggcgagtccccatggtgaccatctca 20053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 30424 - 30095
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| ||||||||||||||||||    
30424 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctga 30325  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||    
30324 gaatacggcgcatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctattt 30225  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||| | ||||||||  | ||||||||  |||||||||| || || || || || ||||  |||||    
30224 ccgtttctttcttcttgtggtgtccattaccatacctcctcgatgcattcacagaggattcggctttctcgaacacaatgattccatccctgacggcttc 30125  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
30124 ttccagacgagttcccatggtgaccatctc 30095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 42)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 21703428 - 21703765
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
21703428 ctggtggctgttgttgcatttgttgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 21703527  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||||||||||||| ||||||| ||||||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21703528 atgctgagagtatggcgcatatgggtacgacggaggtaactaggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 21703627  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||    
21703628 cctacttctgtttctttcttcttatgatgaccgttaccgtatctctttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctga 21703727  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     ||||||||||||||||||||||||| || ||||||||    
21703728 cagcttcttctagacgagtccccatggtgaccatctca 21703765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 19456685 - 19457022
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||| | |||||| ||||||||||||||||||||||| ||    
19456685 ctggtggctgttgttgcatttgctaaacgatggcattaacgggcacctgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaagg 19456784  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||||||| ||||||||||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
19456785 atgctgaaagtattgcgcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatc 19456884  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
19456885 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctga 19456984  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     |||||||||||| |||||||||||| || ||||||||    
19456985 cagcttcttctaggcgagtccccatggtgaccatctca 19457022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 33 - 326
Target Start/End: Original strand, 27434743 - 27435036
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||||||| || ||||||||||||||||||||||| ||||||||||||||  ||||||| ||||||||||    
27434743 gcattaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggtggaaagaaaggatgctgagagtacggcgcatatgggtacgacg 27434842  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||    
27434843 gaggcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtcc 27434942  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatg 326  Q
    |||||| |||||||||||||||||  | ||||||||| |||| ||||| || || || ||||||||||  |||||||| |||||||| ||||||    
27434943 gttaccatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatg 27435036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 7 - 338
Target Start/End: Complemental strand, 27392961 - 27392630
Alignment:
7 gctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctg 106  Q
    |||||||||||||||||||| | | |||||| ||||||||||||||||||||||  ||    ||||| || |||||||||||||| ||||| ||||||||    
27392961 gctgttgttgcatttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggcggatactggtgatagaatggtgggaagaaaggatgctg 27392862  T
107 agagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctact 206  Q
    ||||||||||   ||| ||||||  |||  || ||| |||||||  || ||||||||||||||||  ||||||| || ||||||||||||||||||||||    
27392861 agagtattgcatgtactggtacggtggaggtagctgagcagcatcgatgggggcaacagtagccacagattgactggttccggcagataccatccctact 27392762  T
207 tctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagctt 306  Q
    ||||| |||||||||||||||||||| ||||| ||| || ||||||||||||| ||||||||| ||||||| || || |||||||| ||||||| ||| |    
27392761 tctgtctctttcttcttatgatgaccattaccatacttccttgatgcatttgcagaggattcacctttctcaaacacaataatgccgtctctgacagcct 27392662  T
307 cttctagacgagtccccatgatgtccatctca 338  Q
    ||||||  || || |||||| || ||||||||    
27392661 cttctaagcgggttcccatggtgaccatctca 27392630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 23128840 - 23129169
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
23128840 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 23128939  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
23128940 gaatacggcgcatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 23129039  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || |||||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  |||||    
23129040 ccgtttctttcttcttgtggtgtccgttaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttc 23129139  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
23129140 ctccagacgggttcccatggtgaccatctc 23129169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 27118665 - 27118515
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
27118665 ctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 27118566  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    |||||||||||||||||||| |||||||||||||  || ||| ||||||||    
27118565 atgctgagagtattgcgcatgcgggtacgacggaggtagctgagcagcatt 27118515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 28882181 - 28881852
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
28882181 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 28882082  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||    
28882081 gaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctattt 28881982  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || || || |||| ||||||    
28881981 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacagcttc 28881882  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
28881881 ttccagacgagttcccatggtgaccatctc 28881852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 3784631 - 3784481
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
3784631 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 3784532  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
3784531 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 3784481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 31891592 - 31891742
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||    
31891592 ctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaagg 31891691  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||||||||||||||  || ||| ||||||||    
31891692 atgctgagagtattgcgcatacgggtacgacggaggtagctgagcagcatt 31891742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 34156988 - 34156838
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
34156988 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 34156889  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
34156888 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 34156838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 16163576 - 16163426
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||    
16163576 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaaggg 16163477  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
16163476 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 16163426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 34303567 - 34303717
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
34303567 ctggaggctgttgttgcattcgctggacgacgacattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 34303666  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
34303667 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 34303717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 20837885 - 20837556
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| |||||  || || |||||||| ||||| |||||||| |||||||||    
20837885 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctga 20837786  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||||||||||||||||||||||| | || ||||| |||||||    
20837785 gaatacggcgcatatgggtaggacggatgcatttgggctgcattgataggagcaacagtagccatggattgaccggctccgactgacaccattcctactt 20837686  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | | ||||||| |||||||||| || || || ||||| ||||  |||||    
20837685 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagtggattcagctttctcgaacacaatgattccttccctgacggcttc 20837586  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || |||||||| |||||| || |||||||    
20837585 ctccagacgagttcccatggtgaccatctc 20837556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 12655509 - 12655180
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| |||||  || || |||||||| ||||| |||||||| |||||||||    
12655509 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctga 12655410  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||||||||||||||||||||||| | || ||||| |||||||    
12655409 gaatacggcgcatatgggtaggacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccgactgacaccattcctactt 12655310  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | |||| |||| |||||||||| || || || ||||| ||||  |||||    
12655309 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagagggttcagctttctcgaacacaatgattccttccctgacggcttc 12655210  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
12655209 ctccagacgggttcccatggtgaccatctc 12655180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 45 - 337
Target Start/End: Complemental strand, 37375091 - 37374799
Alignment:
45 acctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactggg 144  Q
    ||||||||||| |||| ||||||||| || |||||||| || || || ||||| ||||||||||||||  || |||| ||||| ||||||   |  || |    
37375091 acctgaggttggcccggtggcaaagggtactgatgataaaacggcgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgag 37374992  T
145 cagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacct 244  Q
      || || ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||    
37374991 ttgcgttgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacct 37374892  T
245 ctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 337  Q
    ||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || |||||||    
37374891 cttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 37374799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 13936843 - 13937087
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || ||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
13936843 gcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 13936942  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
13936943 gaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 13937042  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
13937043 attaccatatctcttcgacgcattcacagaggattcagctttctc 13937087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 253
Target Start/End: Original strand, 21677481 - 21677701
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| | ||    
21677481 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatggcg 21677580  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
21677581 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 21677680  T
233 gttaccgtacctctttgatgc 253  Q
     ||||| |||||||| |||||    
21677681 attaccatacctcttcgatgc 21677701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 34279391 - 34279147
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || ||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
34279391 gcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 34279292  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
34279291 gaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtcc 34279192  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| || | |||  | ||||||||| |||||||    
34279191 attaccatacctcttcgacgtattcacagaggattcagctttctc 34279147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 37925435 - 37925191
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
37925435 gcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 37925336  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
37925335 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 37925236  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
37925235 attaccatatctcttcgatgcactcacagaggattcagctttctc 37925191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 261064 - 261308
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||    
261064 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacg 261163  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
261164 gaggcatttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 261263  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| ||||||||  | ||||||||| |||||||    
261264 attaccatacctcttcgatgcattcacagaggattcagctttctc 261308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 39 - 254
Target Start/End: Original strand, 12716910 - 12717125
Alignment:
39 acgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 138  Q
    ||||| || ||||| || |||| ||||||||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
12716910 acgggcacttgaggctggcccggtggcaaagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 12717009  T
139 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 238  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
12717010 tttgagctgcattgataggtgcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 12717109  T
239 gtacctctttgatgca 254  Q
     |||||||| ||||||    
12717110 atacctcttcgatgca 12717125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 247
Target Start/End: Original strand, 11635488 - 11635702
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
11635488 gcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 11635587  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| | |||||||||||| || || ||    
11635588 gaggcatttgagctgcattgataggagcaacggtagccatggattgaccggctcctgctgacaccatccccacttccgcttctttcttcttgtggtgtcc 11635687  T
233 gttaccgtacctctt 247  Q
     ||||| ||||||||    
11635688 attaccatacctctt 11635702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 247
Target Start/End: Original strand, 11641677 - 11641891
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
11641677 gcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 11641776  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| | |||||||||||| || || ||    
11641777 gaggcatttgagctgcattgataggagcaacggtagccatggattgaccggctcctgctgacaccatccccacttccgcttctttcttcttgtggtgtcc 11641876  T
233 gttaccgtacctctt 247  Q
     ||||| ||||||||    
11641877 attaccatacctctt 11641891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 8 - 277
Target Start/End: Complemental strand, 34286321 - 34286052
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| | || ||||| ||||||||  |||||||||||| ||||| ||| || ||||| || ||||| |||||||| ||||||||     
34286321 ctgttgtttcatctgttgagcaactgcattgacgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgg 34286222  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||| ||||||||||||||||||||  | || |||||||||||||    
34286221 gaatacggcatatatgggtatgacggaggcatttgagccgcattgataggagcaacagtggccatggattgaccggctccacctgacaccatccctactt 34286122  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |||||||    
34286121 ccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagctttctc 34286052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 8 - 277
Target Start/End: Complemental strand, 34291381 - 34291112
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| | || ||||| ||||||||  |||||||||||| ||||| ||| || ||||| || ||||| |||||||| ||||||||     
34291381 ctgttgtttcatctgttgagcaactgcattgacgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgg 34291282  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||| ||||||||||||||||||||  | || |||||||||||||    
34291281 gaatacggcatatatgggtatgacggaggcatttgagccgcattgataggagcaacagtggccatggattgaccggctccacctgacaccatccctactt 34291182  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |||||||    
34291181 ccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagctttctc 34291112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 16829637 - 16829858
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
16829637 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 16829736  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| || || ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
16829737 gaggcatttgagttgcattgatgggagcaacggtagccatggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtcc 16829836  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
16829837 attaccatacctcttcgatgca 16829858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 16891844 - 16891623
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
16891844 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 16891745  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| || || ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
16891744 gaggcatttgagttgcattgatgggagcaacggtagccatggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtcc 16891645  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
16891644 attaccatacctcttcgatgca 16891623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 31876223 - 31876002
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
31876223 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 31876124  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
31876123 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 31876024  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
31876023 attaccgtaccttttcgatgca 31876002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 34861622 - 34861401
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
34861622 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 34861523  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
34861522 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 34861423  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
34861422 attaccgtaccttttcgatgca 34861401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 37686208 - 37686429
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
37686208 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 37686307  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
37686308 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 37686407  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
37686408 attaccgtaccttttcgatgca 37686429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 37701473 - 37701694
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
37701473 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 37701572  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
37701573 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 37701672  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
37701673 attaccgtaccttttcgatgca 37701694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 39890004 - 39889783
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||  ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
39890004 gcattgacgggcacttgaggctggccctgtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 39889905  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
39889904 gaggcatttgagctgcattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 39889805  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
39889804 attaccatacctcttcgatgca 39889783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 40233441 - 40233197
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| |||||  || || ||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||    
40233441 gcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacg 40233342  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
40233341 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 40233242  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
40233241 attaccatatctcttcgacgcattcacagaggattcagctttctc 40233197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 19416798 - 19417042
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
19416798 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 19416897  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || ||    
19416898 gaggcatttgagccgcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 19416997  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
19416998 attaccatatctcttcgacgcattcacagaggattcagctttctc 19417042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 253
Target Start/End: Original strand, 22926327 - 22926547
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
22926327 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 22926426  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
22926427 gaggcatttgagctgcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtcc 22926526  T
233 gttaccgtacctctttgatgc 253  Q
     ||||| |||||||| |||||    
22926527 attaccatacctcttcgatgc 22926547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 147 - 277
Target Start/End: Complemental strand, 12586629 - 12586499
Alignment:
147 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 246  Q
    ||||| ||||| |||||||||| |||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
12586629 gcattgataggagcaacagtagtcatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 12586530  T
247 ttgatgcatttgcggaggattcaactttctc 277  Q
    | || |||||  | ||||||||| |||||||    
12586529 tcgacgcattcacagaggattcagctttctc 12586499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 247
Target Start/End: Complemental strand, 32049740 - 32049526
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| | ||    
32049740 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcg 32049641  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||| ||||| || || ||    
32049640 gaggcatttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttcttttttcttgtggtgtcc 32049541  T
233 gttaccgtacctctt 247  Q
     ||||| ||||||||    
32049540 attaccatacctctt 32049526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 147 - 277
Target Start/End: Original strand, 9350407 - 9350537
Alignment:
147 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 246  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
9350407 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 9350506  T
247 ttgatgcatttgcggaggattcaactttctc 277  Q
    | || |||||  | ||||||||| |||||||    
9350507 tcgacgcattcacagaggattcagctttctc 9350537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 147 - 277
Target Start/End: Complemental strand, 27777035 - 27776905
Alignment:
147 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 246  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
27777035 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27776936  T
247 ttgatgcatttgcggaggattcaactttctc 277  Q
    | || |||||  | ||||||||| |||||||    
27776935 tcgacgcattcacagaggattcagctttctc 27776905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 147 - 277
Target Start/End: Complemental strand, 27803520 - 27803390
Alignment:
147 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 246  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
27803520 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27803421  T
247 ttgatgcatttgcggaggattcaactttctc 277  Q
    | || |||||  | ||||||||| |||||||    
27803420 tcgacgcattcacagaggattcagctttctc 27803390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 147 - 277
Target Start/End: Complemental strand, 27816802 - 27816672
Alignment:
147 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 246  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
27816802 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27816703  T
247 ttgatgcatttgcggaggattcaactttctc 277  Q
    | || |||||  | ||||||||| |||||||    
27816702 tcgacgcattcacagaggattcagctttctc 27816672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 39 - 277
Target Start/End: Original strand, 39052133 - 39052371
Alignment:
39 acgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 138  Q
    ||||| || ||||||||||||| |||||  || || ||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
39052133 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 39052232  T
139 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 238  Q
      || || |||||  |||| ||||| || || || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
39052233 tttgagctgcattggtaggagcaacggttgctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 39052332  T
239 gtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     || ||||| || |||||  | ||||||||| |||||||    
39052333 atatctcttcgacgcattcacagaggattcagctttctc 39052371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 30)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 16041305 - 16040980
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||    
16041305 ctggtggctgttgttgcatttgctgaacgacggaattaacgggtacctgaggttgacccgatgacaaaggatactgatgatagaatggtggaaagaaggg 16041206  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||||||||||||| ||||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16041205 atgctgagagtatggcgcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 16041106  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
16041105 cctacttctgtttctttcttcttatgatgaccgttaccatacctctttgatgcatttacggaggattcaactttctcgaatacaataatgccttctctga 16041006  T
301 tagcttcttctagacgagtccccatg 326  Q
     |||||||||||||||||| ||||||    
16041005 cagcttcttctagacgagttcccatg 16040980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 16450159 - 16450496
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||    
16450159 ctggtggctgttgttgcacttgctgaacgacggcattaatgggtacctgaggttgacccgatggcaaaggatactgatgataaaatggtggaaagaaggg 16450258  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    |||||||||||| ||||| |||||||||||||||  ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
16450259 atgctgagagtactgcgcgtacgggtacgacggaggtaactgggcagcattaataggggcaacagtagctatggattgaccggctccggcagataccatc 16450358  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    ||||||| ||||||||||||||||||||||||||||||||| || |||||||||||| | ||||||||||||||||||||||| ||||||||||||||||    
16450359 cctacttttgtttctttcttcttatgatgaccgttaccgtatctttttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctga 16450458  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     ||||||||||||||||||||||||| || ||||||||    
16450459 cagcttcttctagacgagtccccatggtgaccatctca 16450496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 16518612 - 16518916
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| |||||||| ||||||||||||||  ||||||| ||||| ||||    
16518612 gcattaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtatgacg 16518711  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||    
16518712 gaggcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtcc 16518811  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
    |||||| |||||||||||||||||| | ||||||||| |||| ||||| || || || ||||||||||  |||||||| |||||||| |||||| || ||    
16518812 gttaccatacctctttgatgcatttacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgacc 16518911  T
333 atctc 337  Q
    |||||    
16518912 atctc 16518916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 16503576 - 16503880
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| |||||||| ||||||||||||||  ||||||| ||||| ||||    
16503576 gcattaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtatgacg 16503675  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||    
16503676 gaggcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtcc 16503775  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
    |||||| |||||||||||||||||  | ||||||||| |||| ||||| || || || ||||||||||  |||||||| |||||||| |||||| || ||    
16503776 gttaccatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgacc 16503875  T
333 atctc 337  Q
    |||||    
16503876 atctc 16503880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 31088625 - 31088775
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
31088625 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 31088724  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
31088725 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 31088775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 45733442 - 45733292
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
45733442 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 45733343  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
45733342 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 45733292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 2154520 - 2154216
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||| ||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||    
2154520 gcattaacggatacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacg 2154421  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || ||    
2154420 gaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtcc 2154321  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||||||||||||  | ||||||||| |||||||||| || || ||  | || ||||  |||||||| |||||||| |||||| || ||    
2154320 attaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgatttcatccctgacggcttcttccagacgagttcccatggtgacc 2154221  T
333 atctc 337  Q
    |||||    
2154220 atctc 2154216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 8 - 277
Target Start/End: Original strand, 10917036 - 10917305
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||| ||||| ||||||||||||| ||||| |||||| |||||||| ||||| ||||||||||||||||||    
10917036 ctgttgtttcatctgttgagcgattgcattaacaggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaagggatgctga 10917135  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| |||| |   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
10917136 gaatacggcacatatgggtatgacgaaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 10917235  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||    
10917236 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctc 10917305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 5127939 - 5127635
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||| |||||| |||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||    
5127939 gcattaacgggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacg 5127840  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || ||    
5127839 gaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtcc 5127740  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| ||||||||  | ||||| ||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || ||    
5127739 attaccatacctcttcgatgcattcacagaggactcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgacc 5127640  T
333 atctc 337  Q
    |||||    
5127639 atctc 5127635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 11424947 - 11425276
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || ||||| || ||||| |||||||| |||||||||    
11424947 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctga 11425046  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||  ||| ||||| ||||||   |  |||||  |||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
11425047 gaatacggcatatatgggtatgacggaggcatttgggctacattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 11425146  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
11425147 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 11425246  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
11425247 ctccagacgggttcccatggtgaccatctc 11425276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 16736656 - 16736900
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
16736656 gcattgacgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 16736755  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    || | |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
16736756 gagacatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 16736855  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || ||| | || || |||||| |||||||    
16736856 attaccatatctcttcgacgcactcgcagaagattcagctttctc 16736900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 16751710 - 16751954
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
16751710 gcattgacgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 16751809  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    || | |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
16751810 gagacatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 16751909  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || ||| | || || |||||| |||||||    
16751910 attaccatatctcttcgacgcactcgcagaagattcagctttctc 16751954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 17523479 - 17523235
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
17523479 gcattgacgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 17523380  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    || | |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
17523379 gagacatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 17523280  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || ||| | || || |||||| |||||||    
17523279 attaccatatctcttcgacgcactcgcagaagattcagctttctc 17523235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 17529736 - 17529980
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
17529736 gcattgacgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 17529835  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    || | |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
17529836 gagacatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 17529935  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || ||| | || || |||||| |||||||    
17529936 attaccatatctcttcgacgcactcgcagaagattcagctttctc 17529980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 5147536 - 5147780
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || |||||||| || ||||| ||||| ||||||||||||||  ||  ||| || || ||||    
5147536 gcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatggatatgacg 5147635  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||  ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
5147636 gaggcatttgagctgcattgataggagcaatggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 5147735  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| |||||||| || || |||||| |||||||    
5147736 attaccatacctcttcgatgcattcgcagaagattcagctttctc 5147780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 45387290 - 45387046
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
45387290 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 45387191  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
45387190 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 45387091  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| || ||| |||| || |||||| |||||||    
45387090 attaccatacctcttcgacgcacttgcagaagattcagctttctc 45387046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 32 - 253
Target Start/End: Original strand, 4145318 - 4145539
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| |||    
4145318 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgac 4145417  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || |    
4145418 ggaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtc 4145517  T
232 cgttaccgtacctctttgatgc 253  Q
    | ||||| |||||||| |||||    
4145518 cattaccatacctcttcgatgc 4145539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 31124858 - 31124614
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| | ||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
31124858 gcattgacgggcacttgaggctggcccggttgcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 31124759  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||||||||| |||||||||||||| || || ||    
31124758 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtcc 31124659  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||||| || ||||||||| |||||||    
31124658 attaccatatctcttcgatgcattcgcagaggattcagctttctc 31124614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 26275290 - 26275511
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
26275290 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 26275389  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
26275390 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 26275489  T
233 gttaccgtacctctttgatgca 254  Q
     |||||||||||||| ||||||    
26275490 attaccgtacctcttcgatgca 26275511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 9618598 - 9618354
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
9618598 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 9618499  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
9618498 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 9618399  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
9618398 attaccatatctcttcgatgcactcacagaggattcagctttctc 9618354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 11441507 - 11441263
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||    
11441507 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacg 11441408  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
11441407 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 11441308  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||| | ||||||||| |||||||    
11441307 attaccatatctcttcgacgcatttacagaggattcagctttctc 11441263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 24592737 - 24592981
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
24592737 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 24592836  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
24592837 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 24592936  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||| | ||||||||| |||||||    
24592937 attaccatatctcttcgacgcatttacagaggattcagctttctc 24592981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 33 - 252
Target Start/End: Original strand, 26320065 - 26320284
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
26320065 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 26320164  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
26320165 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 26320264  T
233 gttaccgtacctctttgatg 252  Q
     |||||||||||||| ||||    
26320265 attaccgtacctcttcgatg 26320284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 33 - 223
Target Start/End: Complemental strand, 26435204 - 26435014
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || |||||||| || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||    
26435204 gcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacg 26435105  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttctt 223  Q
    ||   |  || || ||| | ||||| |||||||| |||||||| ||||||||||| || || |||||||| ||||| ||||||||||||||    
26435104 gaggcatttgagctgcactgataggagcaacagtggccatggactgaccggctcctgctgacaccatccccacttccgtttctttcttctt 26435014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 3445241 - 3445020
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || |||||||||||||  ||||  || || ||||| || || ||||| ||||| ||||||||||||||  ||   || ||||| ||||    
3445241 gcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggtatgacg 3445142  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
3445141 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 3445042  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
3445041 attaccatacctcttcgatgca 3445020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 26485940 - 26486161
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| |||||  || || ||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||    
26485940 gcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacg 26486039  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
26486040 gaggcatttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 26486139  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
26486140 attaccatacctcttcgatgca 26486161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 176
Target Start/End: Complemental strand, 5159470 - 5159326
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  | ||||| ||||| |||    
5159470 ggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggtaggac 5159371  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggat 176  Q
    ||    ||||| |||||||| ||||| ||||||||||||||||||    
5159370 gggggaaactgagcagcattgataggagcaacagtagccatggat 5159326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 31564595 - 31564816
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||| ||||| ||  ||  ||| ||||| ||||    
31564595 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgttgagaatacggcatatatgggtatgacg 31564694  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
31564695 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 31564794  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| || ||||| ||||||    
31564795 attaccatatctcttcgatgca 31564816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 26538069 - 26538313
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| |||||  || || ||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||    
26538069 gcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacg 26538168  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || ||    
26538169 gaggcatttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 26538268  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
26538269 attaccatatctcttcgacgcattcacagaggattcagctttctc 26538313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 26670110 - 26670354
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
26670110 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 26670209  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
26670210 gaggcatttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 26670309  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
26670310 attaccatatctcttcgatgcactcacagaggattcagctttctc 26670354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 59)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 16626822 - 16627158
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| | |||||| ||||||||||| ||||||||||||||    
16626822 ctggtggctgttgttgcatttgctgaacgatggcattaacgggtaccggaggttgacccgatggtagaggatactgatgatagaacggtggaaagaaggg 16626921  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||||||||||||||| ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16626922 atgctgagagtattgtgcatacgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 16627021  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
16627022 cctacttctgtttc-ttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctga 16627120  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
    ||||||||||||| |||||||||||| || ||||||||    
16627121 tagcttcttctaggcgagtccccatggtgaccatctca 16627158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 18530336 - 18529999
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| | |||||| ||||||||||||||||||||||| ||    
18530336 ctggtggctgttgttgcatttgctgaacgacggcattaacgggcacttgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaagg 18530237  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    |||||||||||||||||||||||||||||| |||  ||||||||||||||||||||||| ||||||||||||||||||||  | ||||||||||||||||    
18530236 atgctgagagtattgcgcatacgggtacgatggaggtaactgggcagcattaataggggtaacagtagccatggattgactagttccggcagataccatc 18530137  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||    
18530136 cctacttctgtttctttcttcttatgatgaccgttaccgtatctctttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctga 18530037  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     ||||||||||||||||||||||||| || ||||||||    
18530036 cagcttcttctagacgagtccccatggtgaccatctca 18529999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 33 - 326
Target Start/End: Original strand, 15893057 - 15893350
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||||||| || ||||||||||| || |||||||| ||||||||||||||  ||||||| ||||||||||    
15893057 gcattaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaagggcggaaagaaaggatgctgagagtacggcgcatatgggtacgacg 15893156  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||    
15893157 gaggcatttgggcagcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtcc 15893256  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatg 326  Q
    |||||  |||||||||||||||||  | ||||||||| |||||||||| || || || |||||||||| ||||||||| |||||||| ||||||    
15893257 gttactatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacagcttcttccagacgagttcccatg 15893350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 8301615 - 8301919
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||||||| || |||||||||||||| |||||||| ||||||||||| ||  ||||||| | ||||||||    
8301615 gcattaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgagtacgacg 8301714  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||||||||| ||||| |||||| |||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||| || || ||    
8301715 gaggcatttgggcagcattgataggagcaacaatagccatggattgaccggctccggcagacaccatccatacttccgtttctttcttcttgtggtgtcc 8301814  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| ||||||||||| |||||  | ||||||||| |||||||||| || || || ||||| ||||  |||||||| |||||||| |||||| || ||    
8301815 attaccatacctctttgacgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgacc 8301914  T
333 atctc 337  Q
    |||||    
8301915 atctc 8301919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 8295907 - 8295578
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||| ||||| ||||||||||||| || || ||| || |||||||| ||||| |||||||| |||||||||    
8295907 ctgttgtttcatctgttgagcgattgcattaacaggtacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctga 8295808  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
8295807 gaatacggcgcatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctactt 8295708  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || || ||  |||  |||||    
8295707 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccttgacggcttc 8295608  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
8295607 ttccagacgagttcccatggtgaccatctc 8295578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 18051194 - 18050865
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||||||||| |||||||| ||||| |||    
18051194 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgatagaatggcggaaagaaaggatgttga 18051095  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
18051094 gaatacggcgcatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 18050995  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  |||||    
18050994 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttc 18050895  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
18050894 ctccagacgggttcccatggtgaccatctc 18050865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 17994100 - 17994250
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
17994100 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 17994199  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
17994200 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 17994250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 4797004 - 4797308
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||    
4797004 gcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacg 4797103  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || ||    
4797104 gaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtcc 4797203  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  ||||| || ||||| || |||||| || ||    
4797204 attaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgacc 4797303  T
333 atctc 337  Q
    |||||    
4797304 atctc 4797308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 15741433 - 15741737
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||    
15741433 gcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacg 15741532  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || ||    
15741533 gaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtcc 15741632  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     || || |||||||||||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||||| |||||||| |||||| || ||    
15741633 attgccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgacc 15741732  T
333 atctc 337  Q
    |||||    
15741733 atctc 15741737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 4625886 - 4625736
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||    
4625886 ctggaggctgttgttgcattcgctggacgacgacattaacgggtacctgaggttgacccgatggcaaaggatactgatgatataatggtggaaagaaggg 4625787  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
4625786 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 4625736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 5652329 - 5652179
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||    
5652329 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgattgcaaacgatactgatgatagaatggtggaaagaaggg 5652230  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
5652229 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 5652179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 35880698 - 35880369
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
35880698 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 35880599  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
35880598 gaatacggcacatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 35880499  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
35880498 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 35880399  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
35880398 ctccagacgggttcccatggtgaccatctc 35880369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 29149081 - 29149410
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  ||||||||||| || ||||||||||||| ||||||||| || |||||||| || ||||| ||||| |||||||||    
29149081 ctgttgtttcatctgttgagcgattgcattaacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaaaggatgctga 29149180  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||| ||||| ||||| |||| |||||||||||||||||||||||| || || |||||||||||||    
29149181 gaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaatagtagccatggattgaccggctccagctgacaccatccctactt 29149280  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
29149281 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 29149380  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
29149381 ctccagacgggttcccatggtgaccatctc 29149410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 4721538 - 4721234
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || |||||||| ||||| ||||||||  |||||||||| ||  || |||| ||||| ||||    
4721538 gcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaagatgctgagaatacggcacatatgggtatgacg 4721439  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || ||    
4721438 gaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtcc 4721339  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || ||    
4721338 attaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgacc 4721239  T
333 atctc 337  Q
    |||||    
4721238 atctc 4721234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 8 - 279
Target Start/End: Complemental strand, 18330601 - 18330335
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| |||     ||||||| |||||||||||||| |||||||||    
18330601 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagg-----gatgataaaatggtggaaagaaaggatgctga 18330507  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
18330506 gaatacggcacatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 18330407  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcga 279  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||    
18330406 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcga 18330335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 32 - 277
Target Start/End: Complemental strand, 8211649 - 8211404
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  ||||||| ||||| |||    
8211649 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcgcatatgggtatgac 8211550  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
8211549 ggaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 8211450  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | ||||| |||||||| |||||| | || ||||| ||| |||||||    
8211449 cattaccatacctcttcgatgcactcgcagaggactcagctttctc 8211404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 6192223 - 6191919
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || | |||||| ||||| | |||||| ||||||||||| ||  || |||| ||||| ||||    
6192223 gcattgacgggtacttgaggttgacccggtggcagagggtactaatgataaaatggcgaaaagaaaggatgctgagaatacggcacatatgggtatgacg 6192124  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||||||||||||||||||  | || ||||||| |||||| |||||||||||||| || || ||    
6192123 gaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccaactgacaccatccatacttccgtttctttcttcttgtggtgtcc 6192024  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || ||    
6192023 attaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgacc 6191924  T
333 atctc 337  Q
    |||||    
6191923 atctc 6191919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 32 - 337
Target Start/End: Original strand, 18277402 - 18277707
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| |||    
18277402 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgac 18277501  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
18277502 ggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 18277601  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtc 331  Q
    | ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || |    
18277602 cattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgac 18277701  T
332 catctc 337  Q
    ||||||    
18277702 catctc 18277707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 32 - 337
Target Start/End: Original strand, 18292703 - 18293008
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| |||    
18292703 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgac 18292802  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
18292803 ggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 18292902  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtc 331  Q
    | ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || |    
18292903 cattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgac 18293002  T
332 catctc 337  Q
    ||||||    
18293003 catctc 18293008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 32 - 337
Target Start/End: Original strand, 18308004 - 18308309
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| |||    
18308004 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgac 18308103  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
18308104 ggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 18308203  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtc 331  Q
    | ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || |    
18308204 cattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgac 18308303  T
332 catctc 337  Q
    ||||||    
18308304 catctc 18308309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 21 - 277
Target Start/End: Original strand, 5596705 - 5596961
Alignment:
21 tgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcat 120  Q
    |||||| ||| |||||| || || ||||||||||| || | ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||    
5596705 tgctgagcgatggcattgacaggaacctgaggttggccgggtggcaaagggtactgatgataaaacggtgggaagaatggatgctgagaatacggcatat 5596804  T
121 acgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttctt 220  Q
    | ||||||||||||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||    
5596805 atgggtacgacggaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttctt 5596904  T
221 cttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    ||| || || || ||||| |||||||| |||||| | || |||||||||||||||||    
5596905 cttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcaactttctc 5596961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 32 - 247
Target Start/End: Complemental strand, 20065954 - 20065739
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| |||    
20065954 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgac 20065855  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  ||||| ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| || ||||||||||| ||||| |    
20065854 ggaggcatttgggctgcattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtatctttcttcttgtgatgtc 20065755  T
232 cgttaccgtacctctt 247  Q
    | ||||| ||||||||    
20065754 cattaccatacctctt 20065739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 32 - 253
Target Start/End: Complemental strand, 5466893 - 5466672
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| || | ||||||||| || |||||||| |||||||| ||||| ||||||||||| ||  ||  ||| ||||| |||    
5466893 ggcattgacaggaacctgaggttggccgggtggcaaagggtactgatgataaaatggtgggaagaacggatgctgagaatacggcatatatgggtatgac 5466794  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || || ||||| ||||| |||||||||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || |    
5466793 ggaggcatttgagctgcattgataggtgcaacagtagccatagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtc 5466694  T
232 cgttaccgtacctctttgatgc 253  Q
    | ||||| ||||||||||||||    
5466693 cattaccatacctctttgatgc 5466672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 28116308 - 28116612
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
28116308 gcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 28116407  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
28116408 gaggcatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 28116507  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| |||||| | |  || |||||| ||||||| || || ||||| || || ||||  ||||| || ||||| || |||||| || ||    
28116508 attaccatacctcttcgatgcactcgtagaagattcagctttctcaaacacaataattccatccctgacggcttcctcaagacgggttcccatggtgacc 28116607  T
333 atctc 337  Q
    |||||    
28116608 atctc 28116612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 33 - 151
Target Start/End: Complemental strand, 5713134 - 5713016
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
5713134 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5713035  T
133 gaaataactgggcagcatt 151  Q
    ||  || ||| ||||||||    
5713034 gaggtagctgagcagcatt 5713016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 33 - 151
Target Start/End: Complemental strand, 5724044 - 5723926
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
5724044 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5723945  T
133 gaaataactgggcagcatt 151  Q
    ||  || ||| ||||||||    
5723944 gaggtagctgagcagcatt 5723926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 33 - 151
Target Start/End: Original strand, 5757433 - 5757551
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
5757433 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5757532  T
133 gaaataactgggcagcatt 151  Q
    ||  || ||| ||||||||    
5757533 gaggtagctgagcagcatt 5757551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 33 - 151
Target Start/End: Original strand, 5768324 - 5768442
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
5768324 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5768423  T
133 gaaataactgggcagcatt 151  Q
    ||  || ||| ||||||||    
5768424 gaggtagctgagcagcatt 5768442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 32 - 326
Target Start/End: Complemental strand, 10396044 - 10395750
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| ||||| |||||||| |||||||| || ||  ||  ||| ||||| |||    
10396044 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaatggcggaaagaaaggatgctgggaatacggcatatatgggtatgac 10395945  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
10395944 ggaggcatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 10395845  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatg 326  Q
    | ||||| || ||||| ||||||||  | ||||||||| ||||||| || || ||||| || || ||||  ||||| || ||||| || ||||||    
10395844 cattaccatatctcttcgatgcattcacagaggattcagctttctcaaacacaataattccatccctgacggcttcctcaagacgggttcccatg 10395750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 7073119 - 7072875
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || ||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
7073119 gcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 7073020  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||||||||||| |||||| || || |||||||| ||||| |||||||||||||| || || ||    
7073019 gaggcatttgagctgcattgataggagcaacagtagccatggattgactggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 7072920  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| || |||||  | ||||||||| |||||||    
7072919 attaccatacctcttcgacgcattcacagaggattcagctttctc 7072875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 22871225 - 22871469
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || || | ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
22871225 gcattgacgggcacttgaggctggcctggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 22871324  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   | ||| || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
22871325 gaggcatctgagctgcattgataggtgcaacagtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 22871424  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| |||||| | || ||||||||| |||||||    
22871425 attaccatacctcttcgatgcactcgcagaggattcagctttctc 22871469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 22886284 - 22886528
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || || | ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
22886284 gcattgacgggcacttgaggctggcctggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 22886383  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   | ||| || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
22886384 gaggcatctgagctgcattgataggtgcaacagtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 22886483  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| |||||| | || ||||||||| |||||||    
22886484 attaccatacctcttcgatgcactcgcagaggattcagctttctc 22886528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 32 - 254
Target Start/End: Complemental strand, 28021186 - 28020964
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| || | ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| |||    
28021186 ggcattgacaggaacctgaggttggccgggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgac 28021087  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  ||||| | ||| ||||| |||||||||||||||||||| |||||||| || || |||||||| ||||| ||||| |||||||| || || |    
28021086 ggaggcatttgggctgtattgataggagcaacagtagccatggattgcccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtc 28020987  T
232 cgttaccgtacctctttgatgca 254  Q
    ||||||| |||||||||||||||    
28020986 cgttaccatacctctttgatgca 28020964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 17985307 - 17985528
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
17985307 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 17985406  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
17985407 gaggcatttgagctgcattgatgggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 17985506  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| |||||||||    
17985507 attaccgtacctttttgatgca 17985528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 18225098 - 18224877
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
18225098 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 18224999  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
18224998 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtcc 18224899  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
18224898 attaccgtaccttttcgatgca 18224877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 47023360 - 47023116
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| |||||||||||||||| ||||| ||| || |||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||    
47023360 gcattgacgggcacctgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacg 47023261  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
47023260 gaggcatttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 47023161  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| ||||||||  | ||||||||  |||||||    
47023160 attaccatacctcttcgatgcattcacagaggattcggctttctc 47023116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 32 - 254
Target Start/End: Original strand, 4347034 - 4347256
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| || | ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  | | ||||| |||    
4347034 ggcattgacaggaacctgaggttggccgggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatacatgggtatgac 4347133  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  ||||| || || ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
4347134 ggaggcatttgggctgcgttgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 4347233  T
232 cgttaccgtacctctttgatgca 254  Q
    | ||||| |||||||| ||||||    
4347234 cattaccatacctcttcgatgca 4347256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 6542825 - 6543046
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
6542825 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 6542924  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
6542925 gaggcatttgagctgcattgataggtgcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 6543024  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
6543025 attaccatacctcttcgatgca 6543046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 33 - 223
Target Start/End: Original strand, 29665336 - 29665526
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  ||   || ||||| ||||    
29665336 gcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatgtatgggtatgacg 29665435  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttctt 223  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| ||||||||||||||    
29665436 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttctt 29665526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 5013619 - 5013398
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
5013619 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 5013520  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
5013519 gaggcatttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtcc 5013420  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
5013419 attaccgtaccttttcgatgca 5013398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 48 - 277
Target Start/End: Complemental strand, 21674585 - 21674356
Alignment:
48 tgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcag 147  Q
    ||||||||||||| |||||  || || ||||| || ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||   |  || || |    
21674585 tgaggttgacccggtggcagggggtactgatggtaaaatggcggaaagaacggatgctgagaatacggcacatatgggtatgacggaggcatttgagctg 21674486  T
148 cattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctt 247  Q
    |||| ||||| || || |||||||||| |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || |||||    
21674485 cattgataggagccacggtagccatgggttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctctt 21674386  T
248 tgatgcatttgcggaggattcaactttctc 277  Q
     ||||||||  | ||||||||| |||||||    
21674385 cgatgcattcacagaggattcagctttctc 21674356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 7996469 - 7996225
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| | ||    
7996469 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcg 7996370  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
7996369 gaggcatttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 7996270  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| || ||| | || || |||||| |||||||    
7996269 attaccatacctcttcgaggcactcgcagaagattcagctttctc 7996225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 10642977 - 10642733
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| | ||    
10642977 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcg 10642878  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
10642877 gaggcatttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 10642778  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| || ||| | || || |||||| |||||||    
10642777 attaccatacctcttcgaggcactcgcagaagattcagctttctc 10642733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 36997440 - 36997684
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| ||||||||||| || | ||||| ||| || |||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||    
36997440 gcattgacgggcacctgaggttggccgggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacg 36997539  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
36997540 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 36997639  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||| | ||||||||| |||||||    
36997640 attaccatatctcttcgacgcatttacagaggattcagctttctc 36997684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 11110712 - 11110956
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||    
11110712 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacg 11110811  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| ||||| |||||||| || || ||    
11110812 gaggcatttgagttgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtcc 11110911  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
11110912 attaccatatctcttcgacgcattcacagaggattcagctttctc 11110956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 18242634 - 18242390
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||  || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
18242634 gcattgacgggcacttgaggctggcccggcggcaaagagtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 18242535  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || ||    
18242534 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtcc 18242435  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
18242434 attaccatatctcttcgacgcattcacagaggattcagctttctc 18242390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 176
Target Start/End: Original strand, 22387925 - 22388069
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || | ||| ||||| ||||||||||||||| | ||||| ||||| |||    
22387925 ggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacgatgggaagaacggatgctgagagtatggtgcataagggtaggac 22388024  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggat 176  Q
    ||    ||||| |||||||| ||||| ||||||||||||||||||    
22388025 gggggaaactgagcagcattgataggagcaacagtagccatggat 22388069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 24328066 - 24327822
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
24328066 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 24327967  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || ||    
24327966 gaggcatttgagctgcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 24327867  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
24327866 attaccatatctcttcgacgcattcacagaggattcagctttctc 24327822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 253
Target Start/End: Complemental strand, 28339209 - 28338989
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
28339209 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 28339110  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
28339109 gaggcatttgagctgcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtcc 28339010  T
233 gttaccgtacctctttgatgc 253  Q
     ||||| |||||||| |||||    
28339009 attaccatacctcttcgatgc 28338989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 253
Target Start/End: Original strand, 31964824 - 31965044
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
31964824 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 31964923  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
31964924 gaggcatttgagctgcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtcc 31965023  T
233 gttaccgtacctctttgatgc 253  Q
     ||||| |||||||| |||||    
31965024 attaccatacctcttcgatgc 31965044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 253
Target Start/End: Original strand, 50134422 - 50134642
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
50134422 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 50134521  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
50134522 gaggcatttgagctgcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtcc 50134621  T
233 gttaccgtacctctttgatgc 253  Q
     ||||| |||||||| |||||    
50134622 attaccatacctcttcgatgc 50134642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 51781918 - 51781674
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || |||||||||||||  ||||  || || ||||| || || ||||| ||||| ||||||||||||||  ||   || ||||| ||||    
51781918 gcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggtatgacg 51781819  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
51781818 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 51781719  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||| | ||||||||| |||||||    
51781718 attaccatatctcttcgacgcatttacagaggattcagctttctc 51781674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 147 - 277
Target Start/End: Original strand, 20577327 - 20577457
Alignment:
147 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 246  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
20577327 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 20577426  T
247 ttgatgcatttgcggaggattcaactttctc 277  Q
    | || |||||  | ||||||||| |||||||    
20577427 tcgacgcattcacagaggattcagctttctc 20577457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 253
Target Start/End: Complemental strand, 4416823 - 4416603
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| |  |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
4416823 gcattgacgggcacttgaggctggcccggtggcaaagggtgctgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 4416724  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
4416723 gaggcatttgagttgcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 4416624  T
233 gttaccgtacctctttgatgc 253  Q
     ||||| |||||||| |||||    
4416623 attaccatacctcttcgatgc 4416603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 32 - 176
Target Start/End: Complemental strand, 4893121 - 4892977
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  | ||||| ||||| |||    
4893121 ggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggtaggac 4893022  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggat 176  Q
    ||    ||||| |||||||| ||||| |||||||||||| |||||    
4893021 gggggaaactgagcagcattgataggagcaacagtagccttggat 4892977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 32 - 326
Target Start/End: Complemental strand, 32439065 - 32438771
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  | ||||| ||||| |||    
32439065 ggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggtaggac 32438966  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    ||    ||||| |||||||| | ||| |||||||||||| ||||| ||   | ||| || | || ||| || || || || ||||||||||| ||||| |    
32438965 gggggaaactgagcagcattgacaggagcaacagtagccttggatggattagttccagcggctatcattcccacctccgtatctttcttcttgtgatgtc 32438866  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatg 326  Q
    | |||||||| ||||| |  |||||||| || || ||||  ||||| || || || |||||||| |  | ||||||||| ||||| || ||||||    
32438865 cattaccgtatctcttcgcagcatttgcagatgactcaatcttctcaaacacaatgatgccttcccgaacagcttcttccagacgtgttcccatg 32438771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 33 - 250
Target Start/End: Original strand, 5609673 - 5609890
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||   |  ||| ||||| ||||    
5609673 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacgtcatatatgggtatgacg 5609772  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
5609773 gaggcatttgagctgcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtcc 5609872  T
233 gttaccgtacctctttga 250  Q
     ||||| || ||||||||    
5609873 attaccatatctctttga 5609890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 51797007 - 51796762
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || |||||||||||||  ||||  || || ||||| || || ||||| ||||| ||||||||||||||  ||   || ||||| ||||    
51797007 gcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggtatgacg 51796908  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg-ac 231  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || ||  |    
51796907 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtgc 51796808  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | ||||| || ||||| || |||||| | ||||||||| |||||||    
51796807 cattaccatatctcttcgacgcatttacagaggattcagctttctc 51796762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 48465822 - 48465578
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||   || || ||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||    
48465822 gcattgacgggcacttgaggttgacccggtggcggggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacg 48465723  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || ||    
48465722 gaggcatttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 48465623  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
48465622 attaccatatctcttcgacgcattcacagaggattcagctttctc 48465578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 7 - 338
Target Start/End: Complemental strand, 20461079 - 20460748
Alignment:
7 gctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctg 106  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||    
20461079 gctgttgttgcatttgctgaacgatggcattaacgggtacctgaggttgacccgatggtagaggatattgatgatagaatggtggaaagaaaggatgctg 20460980  T
107 agagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctact 206  Q
    ||||||||||||||||||||||| ||||  |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
20460979 agagtattgcgcatacgggtacggcggaggtaactgggcagcattaataggggcaatagtagccatggattgaccggctccggcagataccatccctact 20460880  T
207 tctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagctt 306  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  |||||||||||||||| |||||    
20460879 tctatttctttcttcttatgatgaccgttaccgtacctctttgatgcattggcggaggattcaactttctcgaatataataatgccttctctgacagctt 20460780  T
307 cttctagacgagtccccatgatgtccatctca 338  Q
    ||||||| |||||||||||| || ||||||||    
20460779 cttctaggcgagtccccatggtgaccatctca 20460748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 16208303 - 16208640
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||    ||||| || |||||||||||||| ||||| ||    
16208303 ctggtggctgttgttgcatttgctgaacgatggcattaatgggtacctgaggctgacccgatggtggtggatactggtgatagaatggtgggaagaaagg 16208402  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||||||||||||||||   ||| | |||| ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16208403 atgctgagagtattgcatgtactgatacggcggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 16208502  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
     |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||| ||||| ||||||||||||||||    
16208503 tctacttctgtttctttcttcttatgatgaccgttaccgtaactctttgatgcatttacagaggattcaactttctcaaatacaataatgccttctctga 16208602  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     ||||||||||||||||||||||||| || ||||||||    
16208603 cagcttcttctagacgagtccccatggtgaccatctca 16208640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 20340610 - 20340760
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
20340610 ctggaggctgttgttgcatttgttgaacgacggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 20340709  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    |||||||||||||||||| |||||||||||||||  || ||| ||||||||    
20340710 atgctgagagtattgcgcgtacgggtacgacggaggtagctgagcagcatt 20340760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 41793618 - 41793839
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| ||||| || ||||| ||||| ||||| ||  ||  ||| ||||| ||||    
41793618 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgttgagaatacggcatatatgggtatgacg 41793717  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| || ||||| |||||||||||||| || || ||    
41793718 gaggcatttgggctgcattgataggagcaacggtagccatggattgaccggctccagctgataccattcccacttccgtttctttcttcttgtggtgtcc 41793817  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||||||||||    
41793818 attaccatacctctttgatgca 41793839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 10962615 - 10962371
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
10962615 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 10962516  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
10962515 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 10962416  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| ||||||||  | ||||||||| |||||||    
10962415 attaccatacctcttcgatgcattcacagaggattcagctttctc 10962371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 51638163 - 51637919
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || || | ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
51638163 gcattgacgggcacttgaggctggccgggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 51638064  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
51638063 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 51637964  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| || ||| |||| || |||||| |||||||    
51637963 attaccatacctcttcgacgcacttgcagaagattcagctttctc 51637919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 28584926 - 28584682
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||||||||| ||||    
28584926 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatacgggtatgacg 28584827  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || ||    
28584826 gaggcatttgagctgcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 28584727  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
28584726 attaccatatctcttcgacgcattcacagaggattcagctttctc 28584682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 51)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 25199019 - 25198682
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||    
25199019 ctggtggctgttgttgcatttgctgaacgacggcgttaacgagtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaagg 25198920  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||||||||||||  ||||||| ||||||||||||   || |||| |||||||||||| |||||||||||||||||||||||||||||||| |||||||||    
25198919 atgctgagagtacggcgcatatgggtacgacggaggcaattgggaagcattaataggagcaacagtagccatggattgaccggctccggcggataccatc 25198820  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||||| ||||| ||||||||||    
25198819 cctacttctgtttccttcttcttatgatgtccgttaccgtacctctttgatgcattcacggaggattcaactttctcgaatacaataattccttctctga 25198720  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     ||||||||| ||| ||||||||||| || ||||||||    
25198719 cagcttcttccagatgagtccccatggtgaccatctca 25198682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 3 - 339
Target Start/End: Complemental strand, 23892191 - 23891855
Alignment:
3 ggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggat 102  Q
    |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| ||||    
23892191 ggtggctgttgttgcatttgctgaacgatggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatgttggaaagaaaggat 23892092  T
103 gctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccc 202  Q
    ||||||||||  ||||||| ||||||||||||   |  ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
23892091 gctgagagtacggcgcatatgggtacgacggaggcatttgggcagcattaataggagcaacagtagccatggattgatcggctccggcagataccatccc 23891992  T
203 tacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgata 302  Q
    ||||||||||||||||||||||||||| |||||||| |||||||||||||||||  ||||||||||||||||||||||||| ||||| |||||||||| |    
23891991 tacttctgtttctttcttcttatgatgtccgttaccatacctctttgatgcattcacggaggattcaactttctcgaatacaataattccttctctgaca 23891892  T
303 gcttcttctagacgagtccccatgatgtccatctcat 339  Q
    |||||||| ||||||||||||||| || |||||||||    
23891891 gcttcttccagacgagtccccatggtgaccatctcat 23891855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 22888460 - 22888287
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
22888460 ctggtggctgttgttgcatttgctgaacgacggcattaacggttacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 22888361  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatgg 174  Q
    ||||||||||||| ||||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||    
22888360 atgctgagagtatggcgcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatgg 22888287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 35 - 337
Target Start/End: Original strand, 24688366 - 24688668
Alignment:
35 attaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacgga 134  Q
    |||||||||||| ||||||||||||| ||||| ||| || |||||||||||||| |||||||| ||||| ||||| ||  ||||||| ||||| ||||||    
24688366 attaacgggtacttgaggttgacccggtggcagagggtactgatgatagaatggcggaaagaaaggatgttgagaatacggcgcatatgggtatgacgga 24688465  T
135 aataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgt 234  Q
       |  ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || || |    
24688466 ggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccat 24688565  T
235 taccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtccat 334  Q
    |||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||||||||  |||||||| |||||||| |||||| || ||||    
24688566 taccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccat 24688665  T
335 ctc 337  Q
    |||    
24688666 ctc 24688668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 30934616 - 30934287
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| ||||||||||||||||||    
30934616 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctga 30934517  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||| ||||||||| |||||||||| ||| |||||||||||||    
30934516 gaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagtcatggattggccggctccggtagacaccatccctactt 30934417  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  |||||    
30934416 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttc 30934317  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
30934316 ttccagacgagttcccatggtgaccatctc 30934287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 13184820 - 13184970
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
13184820 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 13184919  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
13184920 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 13184970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 13440666 - 13440816
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
13440666 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 13440765  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
13440766 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 13440816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 33877237 - 33877087
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
33877237 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 33877138  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
33877137 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 33877087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 23752632 - 23752961
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
23752632 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 23752731  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
23752732 gaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 23752831  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
23752832 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 23752931  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
23752932 ttccagacgagttcccatggtgaccatctc 23752961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 11325784 - 11325634
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||    
11325784 ctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctgaggttgtcccaatggcaaaggatactgatgatagaatggtggaaagaaggg 11325685  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
11325684 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 11325634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 23718170 - 23718500
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
23718170 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 23718269  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
23718270 gaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 23718369  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagctt- 306  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||     
23718370 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 23718469  T
307 cttctagacgagtccccatgatgtccatctc 337  Q
    |||| |||||||| |||||| || |||||||    
23718470 cttccagacgagttcccatggtgaccatctc 23718500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 143 - 337
Target Start/End: Complemental strand, 24951955 - 24951761
Alignment:
143 ggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtac 242  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||||| |||    
24951955 ggcagcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgttaccatac 24951856  T
243 ctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 337  Q
    ||||||||||||||  | ||||||||| |||||||||| || || || ||||||||||  |||||||| |||||||| |||||| || |||||||    
24951855 ctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatctc 24951761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 11549334 - 11549005
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| |||||||||||||| ||||||||     
11549334 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggtggaaagaaaggatgctgt 11549235  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
11549234 gaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 11549135  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
11549134 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 11549035  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
11549034 ctccagacgggttcccatggtgaccatctc 11549005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 33777467 - 33777138
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
33777467 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 33777368  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  || || ||||| ||||| ||||||||||||||||||||||| ||||| || || |||||||||||||    
33777367 gaatacggcacatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattgaccagctccagctgacaccatccctactt 33777268  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
33777267 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 33777168  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
33777167 ctccagacgggttcccatggtgaccatctc 33777138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 8 - 280
Target Start/End: Original strand, 22999296 - 22999568
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| |||||||||||||  |||| ||| || |||||||| ||||| |||||||| |||||||||    
22999296 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggcggcagagggtactgatgataaaatggcggaaagaaaggatgctga 22999395  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||    
22999396 gaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctattt 22999495  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaa 280  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| ||||||||||    
22999496 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaa 22999568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 9548750 - 9548994
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || ||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
9548750 gcattgacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 9548849  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| | ||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
9548850 gaggcatttgggctgtattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 9548949  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| |||||| |  | ||||||||| |||||||    
9548950 attaccatacctcttcgatgcactcacagaggattcagctttctc 9548994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 30168424 - 30168180
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
30168424 gcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 30168325  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||| |||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
30168324 gaggcatttgagctgcattgatgggagcaatagtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 30168225  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
30168224 attaccatatctcttcgatgcactcacagaggattcagctttctc 30168180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 41674664 - 41674360
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| |||||| |||||| ||||| ||| || ||||| || ||||| |||||||| ||||||||||  ||  || |||| ||||| ||||    
41674664 gcattgacgggtacttgaggtggacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagcatacggcacatatgggtatgacg 41674565  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| | ||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
41674564 gaggcatttgggctgtattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 41674465  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| || |||||  | ||||||||  ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || ||    
41674464 attaccatacctcttcgacgcattcacagaggattcggctttctcaaacactatgattccatccctgacggcttcctcaagacgggttcccatggtgacc 41674365  T
333 atctc 337  Q
    |||||    
41674364 atctc 41674360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 15658967 - 15659271
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || ||||| || || || |||||||| ||||||||||| ||  || |||| || || ||||    
15658967 gcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaacggcggaaagaaaggatgctgagaatacggcacatatggatatgacg 15659066  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
15659067 gaggcatttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 15659166  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  ||||| || ||||| || |||||| || ||    
15659167 attaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgacc 15659266  T
333 atctc 337  Q
    |||||    
15659267 atctc 15659271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 31431383 - 31431139
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
31431383 gcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 31431284  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||  |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
31431283 gaggcatttgagctgcattgataggagcaacagtagccacagattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtcc 31431184  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
31431183 attaccatatctcttcgatgcactcacagaggattcagctttctc 31431139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 63 - 277
Target Start/End: Complemental strand, 2510976 - 2510762
Alignment:
63 ggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaa 162  Q
    |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| ||||    
2510976 ggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaa 2510877  T
163 cagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcgga 262  Q
    | ||||||||||||||||||||||| || |||||||| || ||||| |||||||||||||| || || || ||||| ||||||||||||||| |  | ||    
2510876 cggtagccatggattgaccggctccagctgataccattcccacttccgtttctttcttcttgtggtgtccattaccatacctctttgatgcactcacaga 2510777  T
263 ggattcaactttctc 277  Q
    ||||||| |||||||    
2510776 ggattcagctttctc 2510762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 18375619 - 18375840
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
18375619 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 18375718  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
18375719 gaggcatttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtcc 18375818  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
18375819 attaccgtaccttttcgatgca 18375840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 33 - 134
Target Start/End: Complemental strand, 24969979 - 24969878
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| |||||||| ||||||||||| ||  ||||||| ||||||||||    
24969979 gcattaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgggtacgacg 24969880  T
133 ga 134  Q
    ||    
24969879 ga 24969878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 3789481 - 3789237
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| |||||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||    
3789481 gcattgacgggcacctgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacg 3789382  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
3789381 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 3789282  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
3789281 attaccatatctcttcgatgcactcacagaggattcagctttctc 3789237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 33 - 253
Target Start/End: Original strand, 8665682 - 8665902
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| || || ||| || |||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| | ||    
8665682 gcattgacgggcacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatggcg 8665781  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
8665782 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 8665881  T
233 gttaccgtacctctttgatgc 253  Q
     ||||| |||||||| |||||    
8665882 attaccatacctcttcgatgc 8665902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 9317406 - 9317162
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
9317406 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 9317307  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
9317306 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 9317207  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| ||||||||||||||| |  | ||||||||| |||||||    
9317206 attaccatacctctttgatgcactcacagaggattcagctttctc 9317162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 39 - 254
Target Start/End: Complemental strand, 24681386 - 24681171
Alignment:
39 acgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 138  Q
    ||||| || ||||| || |||| ||||||||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
24681386 acgggcacttgaggctggcccggtggcaaagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 24681287  T
139 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 238  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
24681286 tttgagctgcattgataggtgcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 24681187  T
239 gtacctctttgatgca 254  Q
     |||||||| ||||||    
24681186 atacctcttcgatgca 24681171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 39 - 254
Target Start/End: Complemental strand, 24723913 - 24723698
Alignment:
39 acgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 138  Q
    ||||| || ||||| || |||| ||||||||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
24723913 acgggcacttgaggctggcccggtggcaaagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 24723814  T
139 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 238  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
24723813 tttgagctgcattgataggtgcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 24723714  T
239 gtacctctttgatgca 254  Q
     |||||||| ||||||    
24723713 atacctcttcgatgca 24723698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 12132110 - 12131889
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
12132110 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 12132011  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
12132010 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 12131911  T
233 gttaccgtacctctttgatgca 254  Q
     |||||||||||||| ||||||    
12131910 attaccgtacctcttcgatgca 12131889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 21 - 254
Target Start/End: Original strand, 32599664 - 32599897
Alignment:
21 tgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcat 120  Q
    |||||| ||| |||||| || || ||||||||||| || | ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||    
32599664 tgctgagcgatggcattgacaggaacctgaggttggccgggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatat 32599763  T
121 acgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttctt 220  Q
    | ||||| ||||||   |  ||||| ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| ||||| |||||    
32599764 atgggtatgacggaggcatttgggctgcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttccttctt 32599863  T
221 cttatgatgaccgttaccgtacctctttgatgca 254  Q
    ||| || || || ||||| |||||||| ||||||    
32599864 cttgtggtgtccattaccatacctcttcgatgca 32599897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 33516311 - 33516090
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
33516311 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 33516212  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
33516211 gaggcatttgagccgcattgatgggagcaacggtagccatggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtcc 33516112  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
33516111 attaccatacctcttcgatgca 33516090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 37671699 - 37671920
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
37671699 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 37671798  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || ||    
37671799 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtcc 37671898  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
37671899 attaccatacctcttcgatgca 37671920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 37771206 - 37771427
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| || |||||||    
37771206 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggatacgacg 37771305  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
37771306 gaggcatttgagctgcattgataggtgcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtcc 37771405  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
37771406 attaccatacctcttcgatgca 37771427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 6874257 - 6874013
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
6874257 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 6874158  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
6874157 gaggcatttgagttgcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 6874058  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| ||||||||||||||| |  | ||||||||| |||||||    
6874057 attaccatacctctttgatgcactcacagaggattcagctttctc 6874013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 33 - 325
Target Start/End: Original strand, 37358862 - 37359154
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
37358862 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 37358961  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
37358962 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 37359061  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccat 325  Q
     ||||| |||||||| |||||| | |  || |||||| ||||||| ||||| || || || |||||||  ||||| || ||||| || |||||    
37359062 attaccatacctcttcgatgcactcgtagaagattcagctttctcaaatacaatgatcccatctctgactgcttcctcaagacgggttcccat 37359154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 147 - 277
Target Start/End: Original strand, 40473873 - 40474003
Alignment:
147 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 246  Q
    ||||| |||||||||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||| ||||    
40473873 gcattgataggggcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtatctct 40473972  T
247 ttgatgcatttgcggaggattcaactttctc 277  Q
    | || |||||  | ||||||||| |||||||    
40473973 tcgacgcattcacagaggattcagctttctc 40474003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 30151973 - 30151752
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
30151973 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 30151874  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
30151873 gaggcatttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtcc 30151774  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
30151773 attaccgtaccttttcgatgca 30151752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 31826626 - 31826847
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
31826626 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 31826725  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
31826726 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 31826825  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
31826826 attaccatacctcttcgatgca 31826847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 32 - 277
Target Start/End: Complemental strand, 34616477 - 34616232
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||  || | ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| |||    
34616477 ggcattgacaggaacctgaggttagccgggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgac 34616378  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  ||||| ||||| ||||| |||||||||||||| | |||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
34616377 ggaggcatttgggctgcattgataggtgcaacagtagccatagcttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 34616278  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | ||||| || ||||| |||||| |  | ||||||||| |||||||    
34616277 cattaccatatctcttcgatgcactcacagaggattcagctttctc 34616232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 5637865 - 5637621
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
5637865 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 5637766  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
5637765 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 5637666  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
5637665 attaccatatctcttcgatgcactcacagaggattcagctttctc 5637621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 15759064 - 15759308
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
15759064 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 15759163  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||| ||||| || || |||||||| ||||| |||||||||||||| || || ||    
15759164 gaggcatttgagctgcattgataggagcaacagtagccattgattgacctgctccagctgacaccatccccacttcagtttctttcttcttgtggtgtcc 15759263  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| || ||| |||| || |||||| |||||||    
15759264 attaccatacctcttcgacgcacttgcagaagattcagctttctc 15759308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 18500955 - 18501199
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||    
18500955 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacg 18501054  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
18501055 gaggcatttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 18501154  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
18501155 attaccatatctcttcgacgcattcacagaggattcagctttctc 18501199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 26480347 - 26480103
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
26480347 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 26480248  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
26480247 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtcc 26480148  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
26480147 attaccatatctcttcgatgcactcacagaggattcagctttctc 26480103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 43078204 - 43077960
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| || |||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||||||||    
43078204 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtacgacg 43078105  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| | |||||||||||| |  || |||||||| ||||| |||||||||||||| || || ||    
43078104 gaggcatttgagctgcattgataggtgcaacagtagccatagcttgaccggctccagttgacaccatccccacttccgtttctttcttcttgtggtgtcc 43078005  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
43078004 attaccatatctcttcgacgcattcacagaggattcagctttctc 43077960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 37754923 - 37754679
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| || || ||||    
37754923 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggatatgacg 37754824  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
37754823 gaggcatttgagctgcattgataggtgcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 37754724  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || ||| |||| || |||||| |||||||    
37754723 attaccatatctcttcgacgcacttgcagaagattcagctttctc 37754679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 28960005 - 28960226
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||  ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
28960005 gcattgacgggcacttgaggctggccctgtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 28960104  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  |||||  |||| ||||| |||||||||||| | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || ||    
28960105 gaggcatttgggctacattgataggtgcaacagtagccgttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 28960204  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
28960205 attaccatacctcttcgatgca 28960226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 13325051 - 13325295
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||| ||||| ||  ||  ||| ||||| ||||    
13325051 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgttgagaatacggcatatatgggtatgacg 13325150  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||| ||||| || || |||||||| ||||| |||||||||||||| || || ||    
13325151 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccagctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 13325250  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
13325251 attaccatatctcttcgatgcactcacagaggattcagctttctc 13325295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 28649181 - 28648937
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
28649181 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 28649082  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || | ||| ||||  |||||||||||||| | |||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
28649081 gaggcatttgagctgtattgatagttgcaacagtagccatagcttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 28648982  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
28648981 attaccatatctcttcgacgcattcacagaggattcagctttctc 28648937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 29967273 - 29967517
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
29967273 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 29967372  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||| || || || ||    
29967373 gaggcatttgagctgcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttctttttgtggtgtcc 29967472  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
29967473 attaccatatctcttcgacgcattcacagaggattcagctttctc 29967517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 30029370 - 30029126
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
30029370 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 30029271  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||| || || || ||    
30029270 gaggcatttgagctgcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttctttttgtggtgtcc 30029171  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
30029170 attaccatatctcttcgacgcattcacagaggattcagctttctc 30029126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 32 - 176
Target Start/End: Complemental strand, 33292484 - 33292340
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  | ||||| ||||| |||    
33292484 ggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggtaggac 33292385  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggat 176  Q
    ||    ||||| |||||||| ||||| |||||||||||| |||||    
33292384 gggggaaactgagcagcattgataggagcaacagtagccttggat 33292340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 165; Significance: 3e-88; HSPs: 22)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 16283395 - 16283091
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||||| |||||||||||||||||| | |||||||||||| | |||||||||||| |||||||| ||||||||||||||  ||||||| ||||||||||    
16283395 gcattaatgggtacctgaggttgacctggtggcaaaggatactaatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtacgacg 16283296  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||    
16283295 gaggcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtcc 16283196  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
    |||||| |||||||||||||||||  | ||||||||| ||||||||||||| || || ||||||||||  |||||||| |||||||| |||||| || ||    
16283195 gttaccatacctctttgatgcattcacagaggattcagctttctcgaatacaatgattccttctctgacggcttcttccagacgagttcccatggtgacc 16283096  T
333 atctc 337  Q
    |||||    
16283095 atctc 16283091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 16277525 - 16277196
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
16277525 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 16277426  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
16277425 gaatacggcgcatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 16277326  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  |||||    
16277325 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttc 16277226  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
16277225 ttccagacgagttcccatggtgaccatctc 16277196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 19688044 - 19687740
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||| ||| || || ||||||||||| |||||||| |||||||| || ||  ||||||| ||||| ||||    
19688044 gcattaacgggtacttgaggttgacccggtggcagagggtactggtgatagaatggcggaaagaaaggatgctgggaatacggcgcatatgggtatgacg 19687945  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||||||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| || || ||    
19687944 gaggcatttgggcagcattgataggagcaacagtagccatggattgaccggctccggctgacaccatccctacttccgtttctttcttcttgtggtgtcc 19687845  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  |||||||| ||||| || |||||| || ||    
19687844 attaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgggttcccatggtgacc 19687745  T
333 atctc 337  Q
    |||||    
19687744 atctc 19687740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 6 - 338
Target Start/End: Original strand, 22081114 - 22081446
Alignment:
6 ggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccg---atggcaaaggatattgatgatagaatggtggaaagaagggat 102  Q
    |||||||| |||||||||||| | | |||||| ||||||||||||||||||||||   |||||   ||||| || ||||| |||||||| ||||| ||||    
22081114 ggctgttgctgcatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggat 22081210  T
103 gctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccc 202  Q
    ||||||||||||||   ||| | |||| ||||  || ||| |||||||| || ||||||||||||||||||||||||| || ||||||||||||||||||    
22081211 gctgagagtattgcatgtactgatacggcggaggtagctgagcagcattgatgggggcaacagtagccatggattgactggttccggcagataccatccc 22081310  T
203 tacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgata 302  Q
    ||||||||| |||||||||||||||||||| || || ||| || ||||||||||||| |||||||||  ||| || || || |||||||| ||||||| |    
22081311 tacttctgtctctttcttcttatgatgaccattgccatacttccttgatgcatttgcagaggattcacatttttcaaacacaataatgccatctctgaca 22081410  T
303 gcttcttctagacgagtccccatgatgtccatctca 338  Q
    || |||||||  || || |||||| || ||||||||    
22081411 gcctcttctaagcgggttcccatggtgaccatctca 22081446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 9354603 - 9354453
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
9354603 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 9354504  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
9354503 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 9354453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 9 - 151
Target Start/End: Original strand, 19659281 - 19659423
Alignment:
9 tgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgag 108  Q
    |||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
19659281 tgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgag 19659380  T
109 agtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||||||  || ||| ||||||||    
19659381 agtattgcgcatacgggtacgacggaggtagctgagcagcatt 19659423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 14557598 - 14557269
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||| ||||| ||||||||||||| ||||| ||| || |||||||| ||||| ||||||||||||||||||    
14557598 ctgttgtttcatctgttgagcgattgcattaacaggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctga 14557499  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||| ||||| ||||| || |||||||||||||||||||||||||| || || |||||||||||||    
14557498 gaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcgacagtagccatggattgaccggctccagctgacaccatccctactt 14557399  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
14557398 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 14557299  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
14557298 ttccagacgagttcccatggtgaccatctc 14557269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 44563082 - 44562932
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||    
44563082 ctggaggctgttgttgcattcgctgaacggcggcattaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaagg 44562983  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||||||||||||||  || ||| ||||||||    
44562982 atgctgagagtattgcgcatacgggtacgacggaggtagctgagcagcatt 44562932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 2137503 - 2137832
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||  |||||||| |||||||||    
2137503 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatgacggaaagaaaggatgctga 2137602  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
2137603 gaatacggcgcatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 2137702  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || | ||| ||||  |||||    
2137703 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattcattccctgacggcttc 2137802  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
2137803 ctccagacgggttcccatggtgaccatctc 2137832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 27609149 - 27609478
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
27609149 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 27609248  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||   | |||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||    
27609249 gaatacgacacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctattt 27609348  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||  |||||||||| || || || || || ||||  |||||    
27609349 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcggctttctcgaacacaatgattccatccctgacggcttc 27609448  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || |||||||| |||||| || |||||||    
27609449 ctccagacgagttcccatggtgaccatctc 27609478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 18710557 - 18710228
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| | || ||||| ||||| ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| |||||||||    
18710557 ctgttgtttcatctgttgagcaactgcattgacgggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctga 18710458  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    |||||  || |||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || ||||| || ||||    
18710457 gagtacggcacatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccattcccactt 18710358  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
18710357 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 18710258  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
18710257 ctcaagacgggttcccatggtgaccatctc 18710228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 19674384 - 19674080
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||| ||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||    
19674384 gcattgacgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacg 19674285  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||||||||||| |||||| || || |||||||| || || |||||||||||||| ||||| ||    
19674284 gaggcatttgagctgcattgataggagcaacggtagccatggattgactggctccagctgacaccatccccacgtccgtttctttcttcttgtgatgtcc 19674185  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| || ||| | || || |||||| |||||||||| || ||||| || || ||||  ||||| || ||||| || |||||| || ||    
19674184 attaccatacctcttcgacgcactcgcagaagattcagctttctcgaacacaataattccatccctgacggcttcctcaagacgggttcccatggtgacc 19674085  T
333 atctc 337  Q
    |||||    
19674084 atctc 19674080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 31490019 - 31490263
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
31490019 gcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 31490118  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| |||||||||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
31490119 gaggcatttgagctgcattgataggggcaacagtagccattgattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtcc 31490218  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
31490219 attaccatatctcttcgacgcattcacagaggattcagctttctc 31490263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 32 - 277
Target Start/End: Complemental strand, 19286412 - 19286167
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||| ||||| || |||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| |||    
19286412 ggcattgacaggaacctgaggttggcccggtggtaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgac 19286313  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || || ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
19286312 ggaggcatttgagctgcattgataggagcaacagtggccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtc 19286213  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | ||||| |||||||| || ||| | || || |||||| |||||||    
19286212 cattaccatacctcttcgacgcactcgcagaagattcagctttctc 19286167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 32 - 253
Target Start/End: Complemental strand, 31354471 - 31354250
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| |||    
31354471 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgac 31354372  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  ||||| ||||| ||||| ||||| || |||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || |    
31354371 ggaggcatttgggctgcattgataggagcaacggtggccatggattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtc 31354272  T
232 cgttaccgtacctctttgatgc 253  Q
    | ||||| |||||||| |||||    
31354271 cattaccatacctcttcgatgc 31354250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 19208629 - 19208850
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
19208629 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 19208728  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
19208729 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 19208828  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||| |||| ||||||    
19208829 attaccgtacttcttcgatgca 19208850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 3329788 - 3330032
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
3329788 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaatggatgctgagaatacggcatatatgggtatgacg 3329887  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||  |||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
3329888 gaggcatttgagctgcattgataggagcaacgatagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 3329987  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
3329988 attaccatatctcttcgacgcattcacagaggattcagctttctc 3330032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 28362224 - 28362468
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
28362224 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 28362323  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
28362324 gaggcatttgagctgcattgatgggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtcc 28362423  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
28362424 attaccatatctcttcgatgcactcacagaggattcagctttctc 28362468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 29829259 - 29829015
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
29829259 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 29829160  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
29829159 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 29829060  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
29829059 attaccatatctcttcgacgcattcacagaggattcagctttctc 29829015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 19518412 - 19518656
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||    
19518412 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacg 19518511  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || |  ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
19518512 gaggcatttgagttgcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 19518611  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
19518612 attaccatatctcttcgacgcattcacagaggattcagctttctc 19518656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 33258669 - 33258425
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
33258669 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 33258570  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || ||    
33258569 gaggcatttgagctgcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgccc 33258470  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
33258469 attaccatatctcttcgacgcattcacagaggattcagctttctc 33258425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 12093002 - 12093306
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||  ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
12093002 gcattgacgggcacttgaggctggccctgtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 12093101  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||| ||||||||| ||||| |||||| | || || ||||| || ||||| |||||||||||||| || || ||    
12093102 gaggcacttgagctgcattgataggagcaatagtagccatagattggccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 12093201  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| || ||||| |||||| | |  || |||||| ||||||| || || || || || |||||||  ||||| || ||||| || |||||| || ||    
12093202 attaccatatctcttcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgacc 12093301  T
333 atctc 337  Q
    |||||    
12093302 atctc 12093306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 153; Significance: 5e-81; HSPs: 3)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 29709 - 29405
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||||||| || |||||||||||||| |||||||| ||||||||||| ||  |||||||||||||||| |    
29709 gcattaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatacgggtacgatg 29610  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||    
29609 gaggcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtcc 29510  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
    |||||| |||||||||||||||||  | ||||||||| |||| ||||| || || || ||||| ||||  |||||||| |||||||| |||||| || ||    
29509 gttaccatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgacc 29410  T
333 atctc 337  Q
    |||||    
29409 atctc 29405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 40379 - 40683
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||||||||||||||||| ||||||||| || ||||||||||||||  ||||||| ||||||||||| ||  ||||||| ||||||| ||    
40379 gcatttacgggtacctgaggttgacccggtggcaaagggtactgatgatagaatggcagaaagaaaggatgctgagaatacggcgcatatgggtacggcg 40478  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||    
40479 gaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtcc 40578  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
    |||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  ||||| || |||||||| |||||| || ||    
40579 gttaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgacc 40678  T
333 atctc 337  Q
    |||||    
40679 atctc 40683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #3
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 47270 - 47599
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| |||||  || || |||||||| ||||| |||||||| |||||||||    
47270 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctga 47369  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| || |||   |  ||||| ||||| ||| | |||||||||||||||| |||||||||||| || || |||||||||| ||    
47370 gaatacggcacatatgggtatgatggaggcatttgggctgcattgataagagcaacagtagccatgggttgaccggctccagctgacaccatccctattt 47469  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  ||||||||||| |||||||||| || || || || || ||||  |||||    
47470 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacggaggattcagctttctcgaacacaatgattccatccctgacggcttc 47569  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| ||||| || |||||| || |||||||    
47570 ttccagacgggttcccatggtgaccatctc 47599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 136; Significance: 7e-71; HSPs: 1)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 7 - 338
Target Start/End: Complemental strand, 21539 - 21208
Alignment:
7 gctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctg 106  Q
    |||||||||||||||||||| | | |||||| ||||||||||||||||||||||  ||    ||||| || |||||||||||||| ||||| ||||||||    
21539 gctgttgttgcatttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggtggatactggtgatagaatggtgggaagaaaggatgctg 21440  T
107 agagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctact 206  Q
    ||||||||||   ||| |||||| ||||  || ||| | |||||| || |||||||||||||||| |||||||| || ||||||||||||||||||||||    
21439 agagtattgcatgtactggtacggcggaggtagctgagaagcattgatgggggcaacagtagccacggattgactggttccggcagataccatccctact 21340  T
207 tctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagctt 306  Q
    ||||| |||||||||||||||||||| ||||| ||| || ||||||||||||| ||||||||| ||||||| || || ||||| || ||||||| ||| |    
21339 tctgtctctttcttcttatgatgaccattaccatacttccttgatgcatttgcagaggattcacctttctcaaacacaataattccgtctctgacagcct 21240  T
307 cttctagacgagtccccatgatgtccatctca 338  Q
    ||||||  || || |||||| || ||||||||    
21239 cttctaagcgggttcccatggtgaccatctca 21208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 129; Significance: 1e-66; HSPs: 41)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 22935130 - 22935434
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||||||||||||||||| |||||| ||||| |||||||||||||| |||||||||||||| ||||| ||  ||||||| ||||| ||||    
22935130 gcattgacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaagggatgttgagaatacggcgcatatgggtatgacg 22935229  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| |||||||||| ||||||||||||||| ||||| || |||||||||| ||| |||||||||||||| || || ||    
22935230 gaggcatttgggctgcattgataggagcaacagtagtcatggattgaccggccccggctgacaccatccctatttccgtttctttcttcttgtggtgtcc 22935329  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
    |||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  |||||||| |||||||| |||||| || ||    
22935330 gttaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgacc 22935429  T
333 atctc 337  Q
    |||||    
22935430 atctc 22935434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 23857575 - 23857879
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||||||||||||||||| |||||| ||||| |||||||||||||| |||||||||||||| ||||| ||  ||||||| ||||| ||||    
23857575 gcattgacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaagggatgttgagaatacggcgcatatgggtatgacg 23857674  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| |||||||||| ||||||||||||||| ||||| || |||||||||| ||| |||||||||||||| || || ||    
23857675 gaggcatttgggctgcattgataggagcaacagtagtcatggattgaccggccccggctgacaccatccctatttccgtttctttcttcttgtggtgtcc 23857774  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
    |||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  |||||||| |||||||| |||||| || ||    
23857775 gttaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgacc 23857874  T
333 atctc 337  Q
    |||||    
23857875 atctc 23857879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 13299179 - 13299508
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
13299179 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 13299278  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||    
13299279 gaatacggcgcatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccagctccggcagacaccatccctactt 13299378  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| || ||||||||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
13299379 ccgtttctttcttcttgtggtgtccattaccatatctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 13299478  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
13299479 ttccagacgagttcccatggtgaccatctc 13299508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 3 - 180
Target Start/End: Original strand, 22477496 - 22477673
Alignment:
3 ggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggat 102  Q
    |||| ||||||||||||||| ||| | |  ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||    
22477496 ggtgactgttgttgcatttgttgagcaattgcattaacgggtacctgaggttgacccgatggcaaaggatactaatgatagaatggtggaaagaagggat 22477595  T
103 gctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgac 180  Q
    |||||||||| |||||||||||||||||| ||  ||| |||||||||||||| |||||||||||||||||||||||||    
22477596 gctgagagtactgcgcatacgggtacgacagaggtaattgggcagcattaattggggcaacagtagccatggattgac 22477673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 20160679 - 20160345
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    ||||||||||||| ||  |||||||| | | ||||||||||||||||||||||||||||| ||| | |||||| ||||| || ||||||||| |||| ||    
20160679 ctggtggctgttgctgtttttgctgagcaatggcattaacgggtacctgaggttgacccggtggtagaggatactgatggtaaaatggtggatagaaagg 20160580  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||| |||||||| || ||| || |||| |  |||  ||| || | |||||||| ||||||||||||||||||||||||||||||    ||| || |||||    
20160579 atgttgagagtaatgtgcaaacaggtatggtggaggtaattgagtagcattaacaggggcaacagtagccatggattgaccggca---gcaaattccatc 20160483  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    |||||||||||||| ||||||||||||||||||||||||||||| |||| |||  |  ||||||||||| |||| || || || || || ||||| ||||    
20160482 cctacttctgtttccttcttcttatgatgaccgttaccgtacctttttggtgcgctcacggaggattcacctttatcaaacacaatgattccttccctga 20160383  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     ||||||||||||||| || |||||| || ||||||||    
20160382 cagcttcttctagacgggttcccatggtgaccatctca 20160345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 22172152 - 22172486
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    ||||||||||||| ||  |||||||| | | ||||||||||||||||||||||||||||| ||| | |||||| ||||| || ||||||||| |||| ||    
22172152 ctggtggctgttgctgtttttgctgagcaatggcattaacgggtacctgaggttgacccggtggtagaggatactgatggtaaaatggtggatagaaagg 22172251  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatc 200  Q
    ||| |||||||| || ||| || |||| |  |||  ||| || | |||||||| ||||||||||||||||||||||||||||||    ||| || |||||    
22172252 atgttgagagtaatgtgcaaacaggtatggtggaggtaattgagtagcattaacaggggcaacagtagccatggattgaccggca---gcaaattccatc 22172348  T
201 cctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctga 300  Q
    |||||||||||||| ||||||||||||||||||||||||||||| |||| |||  |  ||||||||||| |||| || || || || || ||||| ||||    
22172349 cctacttctgtttccttcttcttatgatgaccgttaccgtacctttttggtgcgctcacggaggattcacctttatcaaacacaatgattccttccctga 22172448  T
301 tagcttcttctagacgagtccccatgatgtccatctca 338  Q
     ||||||||||||||| || |||||| || ||||||||    
22172449 cagcttcttctagacgggttcccatggtgaccatctca 22172486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 15424545 - 15424874
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
15424545 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 15424644  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
15424645 gaatacggcgcatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 15424744  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | || |||||| |||||||||| || || || ||||| ||||  |||||    
15424745 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaagattcagctttctcgaacacaatgattccttccctgacggcttc 15424844  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || |||||||| |||||| || |||||||    
15424845 ctccagacgagttcccatggtgaccatctc 15424874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 13522291 - 13522441
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
13522291 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 13522390  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
13522391 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 13522441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 33374474 - 33374624
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
33374474 ctggaggctgttgttgcattcgctggacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 33374573  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
33374574 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 33374624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 26988969 - 26988640
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
26988969 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 26988870  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
26988869 gaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 26988770  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
26988769 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 26988670  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
26988669 ttccagacgagttcccatggtgaccatctc 26988640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 8 - 280
Target Start/End: Original strand, 24304846 - 24305118
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| ||||||||||||||||||    
24304846 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctga 24304945  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| ||||||   |  ||||||||||| ||||| || |||||||||||||||||||||||||| || || |||||||||||||    
24304946 gaatacggcacatatgggtatgacggaggcatttgggcagcattgataggagcgacagtagccatggattgaccggctccagctgacaccatccctactt 24305045  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaa 280  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| ||||||||||    
24305046 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaa 24305118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 24863660 - 24863356
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| || ||||||| || ||| | ||| || |||||||||||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||    
24863660 gcattaacgggtacttggggttgactcggtggtagagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacg 24863561  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| || || ||    
24863560 gaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggctgacaccatccctacttccgtttctttcttcttgtggtgtcc 24863461  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  ||||| || |||||||| | |||| || ||    
24863460 attaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttctcatggtgacc 24863361  T
333 atctc 337  Q
    |||||    
24863360 atctc 24863356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 27000016 - 26999712
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||    
27000016 gcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacg 26999917  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || ||    
26999916 gaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtcc 26999817  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || ||||| ||||  ||||| || ||||| || |||||| || ||    
26999816 attaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgacc 26999717  T
333 atctc 337  Q
    |||||    
26999716 atctc 26999712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 8892528 - 8892678
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||    
8892528 ctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatataatggtggaaagaaggg 8892627  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
8892628 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 8892678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 8903763 - 8903913
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |    
8903763 ctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagag 8903862  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    ||||||||||||||||||||||| ||||||||||  || ||| ||||||||    
8903863 atgctgagagtattgcgcatacgtgtacgacggaggtagctgagcagcatt 8903913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 28162635 - 28162485
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||    
28162635 ctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaagg 28162536  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    |||||||||||||||||||||||||||||| |||  || ||| ||||||||    
28162535 atgctgagagtattgcgcatacgggtacgatggaggtagctgagcagcatt 28162485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 16749822 - 16749493
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| |||||||||    
16749822 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctga 16749723  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  || |||| ||||| |||||| | |  || || || || ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
16749722 gaatacggcacatatgggtatgacggagacatttgagctgcgttgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 16749623  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||| |||||| |  | ||||||||| |||||||||| || || || || || ||||  |||||    
16749622 ccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcacagaggattcagctttctcgaacacaatgatcccatccctgacggcttc 16749523  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
     || ||||| || |||||| || |||||||    
16749522 ctccagacgggttcccatggtgaccatctc 16749493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 33 - 280
Target Start/End: Complemental strand, 26918323 - 26918076
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| |||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||    
26918323 gcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacg 26918224  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || ||    
26918223 gaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtcc 26918124  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaa 280  Q
     ||||| |||||||| ||||||||  | ||||||||| ||||||||||    
26918123 attaccatacctcttcgatgcattcacagaggattcagctttctcgaa 26918076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 32 - 277
Target Start/End: Complemental strand, 29549422 - 29549177
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| |||    
29549422 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgac 29549323  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||||| |    
29549322 ggaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgatgtc 29549223  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | ||||| |||||||| |||||| |  | ||||||||| |||||||    
29549222 cattaccatacctcttcgatgcactcacagaggattcagctttctc 29549177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 32 - 277
Target Start/End: Complemental strand, 27044334 - 27044089
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| |||    
27044334 ggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgac 27044235  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  ||||| ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
27044234 ggaggcatttgggctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 27044135  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | ||||| || ||||| |||||| |  | ||||||||| |||||||    
27044134 cattaccatatctcttcgatgcactcacagaggattcagctttctc 27044089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 32 - 254
Target Start/End: Complemental strand, 4525233 - 4525011
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| || | |||||||||||| |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| |||    
4525233 ggcattgacaggaacctgaggttggcctggtggcaaaggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgac 4525134  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |    
4525133 ggaggcatttgagctgcattgataggtgcaacagtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtc 4525034  T
232 cgttaccgtacctctttgatgca 254  Q
    | ||||| |||||||| ||||||    
4525033 cattaccatacctcttcgatgca 4525011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 21 - 277
Target Start/End: Complemental strand, 29501361 - 29501105
Alignment:
21 tgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcat 120  Q
    |||||| ||| |||||| || || ||||||||||| || | ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||    
29501361 tgctgagcgatggcattgacaggaacctgaggttggccgggtggcaaagggtactgatgataaaacggtgggaagaatggatgctgagaatacggcatat 29501262  T
121 acgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttctt 220  Q
    | ||||||||||||   |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||    
29501261 atgggtacgacggaggcatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttctt 29501162  T
221 cttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    ||| || || || ||||| || ||||| || |||||  |  |||||||| |||||||    
29501161 cttgtggtgtccattaccatatctcttcgacgcattcacaaaggattcagctttctc 29501105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 30558269 - 30558490
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
30558269 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 30558368  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
30558369 gaggcatttgagctgcattgatgggagcaacggtagccatggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtcc 30558468  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
30558469 attaccatacctcttcgatgca 30558490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 17025205 - 17024961
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
17025205 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 17025106  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| ||||| ||||| |||||||||||||| | |||||||||||| || || ||||| || ||||| |||||||||||||| || || ||    
17025105 gaggcatttgggctgcattgataggagcaacagtagccatagcttgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 17025006  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| |||||||| ||||||||  | ||||||||  |||||||    
17025005 attaccatacctcttcgatgcattcacagaggattcggctttctc 17024961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 4757704 - 4757483
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||| ||||| ||  ||  ||| ||||| ||||    
4757704 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgttgagaatacggcatatatgggtatgacg 4757605  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| || ||||||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || ||    
4757604 gaggcatttgagctgcattgataggagcgacagtagccattgattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtcc 4757505  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| |||||||| ||||||    
4757504 attaccatacctcttcgatgca 4757483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 254
Target Start/End: Complemental strand, 29572956 - 29572735
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
29572956 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 29572857  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
29572856 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 29572757  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
29572756 attaccgtaccttttcgatgca 29572735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 3696006 - 3695762
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| |||||  || || |||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||    
3696006 gcattgacgggcacttgaggttgacccggtggcagggggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacg 3695907  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
3695906 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 3695807  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| ||||||||  | ||||||||| |||||||    
3695806 attaccatatctcttcgatgcattcacagaggattcagctttctc 3695762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 4772940 - 4772696
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||| ||||| ||  ||  ||| ||||| ||||    
4772940 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgttgagaatacggcatatatgggtatgacg 4772841  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || ||    
4772840 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtcc 4772741  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
4772740 attaccatatctcttcgatgcactcacagaggattcagctttctc 4772696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 27007655 - 27007411
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  |||  |||| ||||    
27007655 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaatggatgctgagaatacggcatatataggtatgacg 27007556  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
27007555 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 27007456  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| |||||| |  | ||||||||| |||||||    
27007455 attaccatatctcttcgatgcactcacagaggattcagctttctc 27007411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 27485060 - 27484816
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
27485060 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 27484961  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
27484960 gaggcatttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 27484861  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     |||||||| ||||| |||||| |  | ||||||||| |||||||    
27484860 attaccgtatctcttcgatgcactcacagaggattcagctttctc 27484816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 4546037 - 4546341
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
4546037 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 4546136  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||| | || || ||||| || ||||| |||||||||||||| || || ||    
4546137 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 4546236  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| |||||| | |  || |||||| ||||||| || || || || || |||||||  ||||| || ||||| || |||||| || ||    
4546237 attaccatacctcttcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgacc 4546336  T
333 atctc 337  Q
    |||||    
4546337 atctc 4546341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 16944280 - 16944524
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
16944280 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 16944379  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || ||    
16944380 gaggcatttgagctgcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 16944479  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
16944480 attaccatatctcttcgacgcattcacagaggattcagctttctc 16944524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 253
Target Start/End: Original strand, 26777880 - 26778100
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||    
26777880 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacg 26777979  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  ||||| | ||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || ||    
26777980 gaggcatttgggctgtattgataggtgcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 26778079  T
233 gttaccgtacctctttgatgc 253  Q
     ||||| |||||||| |||||    
26778080 attaccatacctcttcgatgc 26778100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 28207385 - 28207081
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
28207385 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 28207286  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||| | || || ||||| || ||||| |||||||||||||| || || ||    
28207285 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 28207186  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| |||||| | |  || |||||| ||||||| || || || || || |||||||  ||||| || ||||| || |||||| || ||    
28207185 attaccatacctcttcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgacc 28207086  T
333 atctc 337  Q
    |||||    
28207085 atctc 28207081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 27360263 - 27360484
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||| ||||| ||  ||  ||| ||||| ||||    
27360263 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgttgagaatacggcatatatgggtatgacg 27360362  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
27360363 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 27360462  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| || ||||| ||||||    
27360463 attaccatatctcttcgatgca 27360484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 27450606 - 27450827
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||| ||||| ||  ||  ||| ||||| ||||    
27450606 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgttgagaatacggcatatatgggtatgacg 27450705  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
27450706 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 27450805  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| || ||||| ||||||    
27450806 attaccatatctcttcgatgca 27450827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 325
Target Start/End: Original strand, 27629962 - 27630254
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||||||||||||| | || |||||||||||||||||||| || || ||||| ||||| ||||||||||| ||| | | | | ||||| |  |    
27629962 gcattcacgggtacctgaggtggtcctgatggcaaaggatattgatggtaaaacggtgggaagaatggatgctgagaatatggtgtacaggggtatggtg 27630061  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||  || ||| ||| |||||| |||||| ||||||||| | || ||||| ||||| |  |||||||| || || |||||||| |||||||| || || ||    
27630062 gaggtagctgagcaacattaacaggggcgacagtagccgtagactgacctgctcccgaggataccattccaacctctgtttccttcttcttgtggtggcc 27630161  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccat 325  Q
     || || |||||||| ||  || |||  || || ||| | ||||| ||||| || || || |||||||  || || |||||||||||||||||    
27630162 attgccatacctcttcgacccacttgtagaagactcacccttctcaaatacaatgataccctctctgacggcctcctctagacgagtccccat 27630254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 34463614 - 34463858
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| |||||  || || ||||| || || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||    
34463614 gcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacg 34463713  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
34463714 gaggcatttgagctgcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 34463813  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
34463814 attaccatatctcttcgacgcattcacagaggattcagctttctc 34463858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 4724396 - 4724617
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
4724396 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 4724495  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||| | || || ||||| || ||||| |||||||||||||| || || ||    
4724496 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 4724595  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| ||||| || ||||||    
4724596 attaccataccttttcgatgca 4724617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 33 - 277
Target Start/End: Complemental strand, 16674070 - 16673826
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||||||||||| |||||  || || ||||| || || ||||| ||||| ||||||||||||||  ||  ||| || || ||||    
16674070 gcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatggatatgacg 16673971  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || ||    
16673970 gaggcatttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 16673871  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||  | ||||||||| |||||||    
16673870 attaccatatctcttcgacgcattcacagaggattcagctttctc 16673826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 26116672 - 26116893
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| | ||||||||| ||  ||  ||| ||||| ||||    
26116672 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacgaatgctgagaatacggcatatatgggtatgacg 26116771  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || | ||| ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
26116772 gaggcatttgagctgtattgataggagcaacggtagctatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 26116871  T
233 gttaccgtacctctttgatgca 254  Q
     ||||| || ||||| ||||||    
26116872 attaccatatctcttcgatgca 26116893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 118; Significance: 4e-60; HSPs: 1)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 27263 - 26934
Alignment:
8 ctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctga 107  Q
    |||||||| ||| || ||| |||  |||||||||||||| ||||||||||||| ||| | ||| || |||||||| ||||| |||||||| |||||||||    
27263 ctgttgtttcatctgttgagcgattgcattaacgggtacttgaggttgacccggtggtagagggtactgatgataaaatggcggaaagaaaggatgctga 27164  T
108 gagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctactt 207  Q
    || ||  ||||||| ||||| ||||||   |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||    
27163 gaatacggcgcatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctactt 27064  T
208 ctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttc 307  Q
    | |||||||||||||| || || || ||||| |||||||||||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||    
27063 ccgtttctttcttcttgtggtgtccattaccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttc 26964  T
308 ttctagacgagtccccatgatgtccatctc 337  Q
    ||| |||||||| |||||| || |||||||    
26963 ttccagacgagttcccatggtgaccatctc 26934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 2933 - 3083
Alignment:
1 ctggtggctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaaggg 100  Q
    |||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
2933 ctggaggctgttgttgcatttgttgaacgacggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaggg 3032  T
101 atgctgagagtattgcgcatacgggtacgacggaaataactgggcagcatt 151  Q
    |||||||||||||||||| |||||||||||||||  || ||| ||||||||    
3033 atgctgagagtattgcgcgtacgggtacgacggaggtagctgagcagcatt 3083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 33 - 337
Target Start/End: Original strand, 440 - 744
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    |||||||||||||| ||||||||||||| ||||| ||| || |||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||    
440 gcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacg 539  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| |  || |||||||||||||| |||||||||||||| || || ||    
540 gaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagttgacaccatccctacttccgtttctttcttcttgtggtgtcc 639  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| ||||||||  | ||||||||| |||||||||| || || || || || ||||  |||||||| ||||| || |||||| || ||    
640 attaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgacc 739  T
333 atctc 337  Q
    |||||    
740 atctc 744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 32 - 277
Target Start/End: Complemental strand, 8179 - 7934
Alignment:
32 ggcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgac 131  Q
    |||||| || || ||||||||||| || | |||||||||||| |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| |||    
8179 ggcattgacaggaacctgaggttggcctggtggcaaaggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgac 8080  T
132 ggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgac 231  Q
    |||   |  || || ||||| ||||| |||||||||||||  |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || |    
8079 ggaggcatttgagctgcattgataggagcaacagtagccacagattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtc 7980  T
232 cgttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
    | ||||| |||||||| ||||||||  | ||||||||| |||||||    
7979 cattaccatacctcttcgatgcattcacagaggattcagctttctc 7934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 15240 - 15461
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||    
15240 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacg 15339  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| || || |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || ||    
15340 gaggcatttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtcc 15439  T
233 gttaccgtacctctttgatgca 254  Q
     ||||||||||| || ||||||    
15440 attaccgtaccttttcgatgca 15461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0350
Description:

Target: scaffold0350; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 7549 - 7770
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
7549 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 7648  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
7649 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 7748  T
233 gttaccgtacctctttgatgca 254  Q
     |||||||||||||| ||||||    
7749 attaccgtacctcttcgatgca 7770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0099 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: scaffold0099
Description:

Target: scaffold0099; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 143 - 337
Target Start/End: Original strand, 48568 - 48769
Alignment:
143 ggcagcattaataggggcaacag-tagccatggattga--ccggctccggca-gataccatccc-tacttctgtttctttcttcttatgatgacc-gtta 236  Q
    ||||||||| ||||| ||||||| |||||||||||||   |||||||||||| || |||||||| |||||| |||||||||||||| || || || ||||    
48568 ggcagcattgataggagcaacaggtagccatggattggacccggctccggcaagacaccatcccctacttccgtttctttcttcttgtggtgtcccgtta 48667  T
237 ccgtacctcttt-gatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 335  Q
    || ||||||||| ||||||||  | ||||||||| |||||||||| || || || ||||||||||  |||||||| |||||||| |||||| || |||||    
48668 ccatacctcttttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 48767  T
336 tc 337  Q
    ||    
48768 tc 48769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 26512 - 26756
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  ||||| || || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
26512 gcattgacgggcacttgaggctggcccggcggcaacgggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 26611  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
26612 gaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtcc 26711  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctc 277  Q
     ||||| || ||||| || |||||| | ||||||||| |||||||    
26712 attaccatatctcttcgacgcatttacagaggattcagctttctc 26756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 337
Target Start/End: Complemental strand, 7883 - 7579
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || |||| ||||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
7883 gcattgacgggcacttgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 7784  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| ||||| |||||||| |||||||||||| | || || ||||| || ||||| |||||||||||||| || || ||    
7783 gaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 7684  T
233 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatactataatgccttctctgatagcttcttctagacgagtccccatgatgtcc 332  Q
     ||||| |||||||| |||||| | |  || |||||| ||||||| || || || || || |||||||  ||||| || ||||| || |||||| || ||    
7683 attaccatacctcttcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgacc 7584  T
333 atctc 337  Q
    |||||    
7583 atctc 7579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 250
Target Start/End: Original strand, 9376 - 9593
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||    
9376 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacg 9475  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 232  Q
    ||   |  || || ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || ||    
9476 gaggcatttgagctgcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtcc 9575  T
233 gttaccgtacctctttga 250  Q
     ||||| || ||||||||    
9576 attaccatatctctttga 9593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 147 - 277
Target Start/End: Complemental strand, 5821 - 5691
Alignment:
147 gcattaataggggcaacagtagccatg-gattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctc 245  Q
    ||||| ||||| ||||||||||||||  |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || |||    
5821 gcattgataggagcaacagtagccatttgattgaccggctccagctgacaccatccc-acttccgtttctttcttcttgtggtgtccattaccatatctc 5723  T
246 tttgatgcatttgcggaggattcaactttctc 277  Q
    || || |||||  | ||||||||| |||||||    
5722 ttcgacgcattcacagaggattcagctttctc 5691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0496 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0496
Description:

Target: scaffold0496; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 33 - 187
Target Start/End: Original strand, 43 - 197
Alignment:
33 gcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 132  Q
    ||||| ||||| || ||||| || ||||  |||||||| || |||||||| || ||||| ||||| ||||||||||| ||  ||  ||| || || ||||    
43 gcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggatatgacg 142  T
133 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctcc 187  Q
    ||   |  || || ||||| ||||| |||||||||||||| ||||||||||||||    
143 gaggcatttgagctgcattgataggtgcaacagtagccattgattgaccggctcc 197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University