View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10500_low_32 (Length: 277)
Name: NF10500_low_32
Description: NF10500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10500_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 14 - 252
Target Start/End: Complemental strand, 36327829 - 36327591
Alignment:
| Q |
14 |
agataaatattgtggtacatggatacgcaaactggctaggcagaggtaccgtattgcaaggcggcgatagaaacacaaacgagtgtgttggtggaaatgt |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36327829 |
agataaatattgtagtacatggatacgcaaactggctaggcagaggtaccgtattgcaaggcggcgatagaaacacaaacgagtgtgttggtggaaatgt |
36327730 |
T |
 |
| Q |
114 |
cataaactttcttgacagtcaaaaagaggaggacaatggaaacatcgtacactttcccgtcatgggaaatgcggtaaactctcctgctgttggacacaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36327729 |
cataaactttcttgacagtcaaaaagaggaggacaatggaaacatcgtacactttcccgtcatgggaaatgcggtaaactctcctgctgttggacacaaa |
36327630 |
T |
 |
| Q |
214 |
ggtggcggaggaaacgtcgttcactttccggggggtgga |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
36327629 |
ggtggcggaggaaacgtcgttcactttccaggcggtgga |
36327591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 14 - 107
Target Start/End: Complemental strand, 36307805 - 36307712
Alignment:
| Q |
14 |
agataaatattgtggtacatggatacgcaaactggctaggcagaggtaccgtattgcaaggcggcgatagaaacacaaacgagtgtgttggtgg |
107 |
Q |
| |
|
||||| |||||| |||||||||||| |||||||||| |||||||||||| ||||||||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
36307805 |
agatagatattggggtacatggatatgcaaactggccaggcagaggtacaatattgcaagccggctatagaaacacaaacgagtgtggtggtgg |
36307712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 16 - 97
Target Start/End: Complemental strand, 36345801 - 36345720
Alignment:
| Q |
16 |
ataaatattgtggtacatggatacgcaaactggctaggcagaggtaccgtattgcaaggcggcgatagaaacacaaacgagt |
97 |
Q |
| |
|
|||||||||| |||||||||||| | ||| |||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36345801 |
ataaatattgaggtacatggatatgaaaattggctaagcagaggtacaatattgcaaggcggcgatagaaacacaaacgagt |
36345720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 14 - 111
Target Start/End: Complemental strand, 36337738 - 36337641
Alignment:
| Q |
14 |
agataaatattgtggtacatggatacgcaaactggctaggcagaggtaccgtattgcaaggcggcgatagaaacacaaacgagtgtgttggtggaaat |
111 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||| | ||| || ||||||||| || |||||||||||||| ||||||| |||||||||| |
|
|
| T |
36337738 |
agataaatattggggtacatgaatatgcaaactggctaggtaaaggcacactattgcaagaaggtgatagaaacacaaatgagtgtggtggtggaaat |
36337641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 40 - 99
Target Start/End: Complemental strand, 36306681 - 36306620
Alignment:
| Q |
40 |
gcaaactggctaggcagaggtaccgtattgcaag--gcggcgatagaaacacaaacgagtgt |
99 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36306681 |
gcaaactcgctaggcagaggcaccgtattgcaagctccggcgatagaaacacaaacgagtgt |
36306620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 87
Target Start/End: Complemental strand, 36324118 - 36324049
Alignment:
| Q |
14 |
agataaatattgtggtacatggatacgcaaactggctaggcagaggtaccgtattgcaaggcggcgatagaaac |
87 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
36324118 |
agataaatattggggtacatggatatgcaaactg----ggcagaggtacaatattgcaagggggcgattgaaac |
36324049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University