View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10500_low_34 (Length: 263)
Name: NF10500_low_34
Description: NF10500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10500_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 12 - 263
Target Start/End: Complemental strand, 38322532 - 38322284
Alignment:
| Q |
12 |
ggaggagcagagatcatgcccttttttgcaatgcagaacgcgtctgacaaggaactacatggctgtaacagaannnnnnnataaaataaaaaggtaaaac |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38322532 |
ggagcagcagagatcatgcccttttttgcaatgcagaacgcgtctgacaaggaactacatggctgtaacagagtttttttataaaataaaaaggtaaaac |
38322433 |
T |
 |
| Q |
112 |
tatgaaaattcttgtgtcgagagaaacaactcgacttctctgggtgtatgggatacaatgaaaaatcaagagaaaactaataaggtaaatgacagaacat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38322432 |
tatgaaaattcttgtgtcgagagaaacaactcgacttctctgggtgtatgggatacaatgaaaaatcaagagaaaactaagaaggtaaatgacagaacat |
38322333 |
T |
 |
| Q |
212 |
ttgaatgttagaagaagaagaagtgcaaaagacttccagtggccgaagttgc |
263 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38322332 |
ttgaatgttagaagaa---gaagtgcaaaagacttccagtggccgaagttgc |
38322284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University