View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10500_low_35 (Length: 253)
Name: NF10500_low_35
Description: NF10500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10500_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 52392926 - 52393164
Alignment:
| Q |
1 |
tttttctatatttactcaacacatataagggaaatgtctgtaccaannnnnnnnnnnnnnnnnggggaacggattctaagatgtattgtaaatataggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
52392926 |
tttttctatatttactcaacacatataagggaaatgtctgtaccaaaaaaataataataa---ggagaacggattctaagatgtattgtaaatataggaa |
52393022 |
T |
 |
| Q |
101 |
attcagtattaaatttaattaacataacaaaaattgttttttccttttcctaaacaaaggatcgtgttttctggatttttctagtcatgtgctacggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52393023 |
attcagtattaaatttaattaacataacaaaaattgttttttccttttcctaaacaaaggatcgtgttttctggatttttctagtcatgtgctacggttt |
52393122 |
T |
 |
| Q |
201 |
gggcttttgtcttctgctttgttgtgagttgtttttgttcat |
242 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52393123 |
gggcttttgtctgctgctttgttgtgagttgtttttgttcat |
52393164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University