View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10500_low_39 (Length: 250)
Name: NF10500_low_39
Description: NF10500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10500_low_39 |
 | |
|
| [»] scaffold0028 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0028 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 56 - 229
Target Start/End: Original strand, 121088 - 121261
Alignment:
| Q |
56 |
ttccttagttttgttaagaatccttttcctgttttgtcttttaagtgttgcatttgattgttggagcactgtttcatcatggctaacagatttgtttcgt |
155 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
121088 |
ttccttagttttgttaagaatcctttttctgttttctcttttaagtgttgcatttgattgttggagcactgtttcatcatggctaacagatttgtttcgt |
121187 |
T |
|
| Q |
156 |
ttccctattggtttgatagttgaagtttgtgaattaatatttgatgttgaacctattttcttcccttctaaaag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
121188 |
ttccctattggtttgatagttgaagtttgtgaattaatatttgatgttgaacctattttcttcccttctaaaag |
121261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 121052 - 121090
Alignment:
| Q |
1 |
gtattggtttgaccacttgaggagaaggagtacaaattc |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
121052 |
gtattggtttgaccacttgaggagaaggagtacaaattc |
121090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 64 - 134
Target Start/End: Original strand, 23690113 - 23690183
Alignment:
| Q |
64 |
ttttgttaagaatccttttcctgttttgtcttttaagtgttgcatttgattgttggagcactgtttcatca |
134 |
Q |
| |
|
||||||||||||||||||||||||| | |||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
23690113 |
ttttgttaagaatccttttcctgttgtctcttcctttggttgcatttgattgttgaagcactgtttcatca |
23690183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University