View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10500_low_44 (Length: 243)

Name: NF10500_low_44
Description: NF10500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10500_low_44
NF10500_low_44
[»] chr8 (1 HSPs)
chr8 (1-225)||(29847580-29847804)


Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 29847580 - 29847804
Alignment:
1 ttcttcaacccttatggctcagcagcatacaacttcatcacaatgagtgcttatagaggtggactcaacacttttgctatcactggtctttcttcaaagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
29847580 ttcttcaacccttatggctcagcagcatacaacttcatcacaatgagtgcttatagaggtggacttaacacttttgctatcactggtctttcttcaaagc 29847679  T
101 ctcttcatgtttatggaaatcctacttatgaatgtgagtggatccctaacactaacacaaacacaaactcttcaaaaaacatcaccaccattggttacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29847680 ctcttcatgtttatggaaatcctacttatgaatgtgagtggatccctaacactaacacaaacacaaactcttcaaaaaacatcaccaccattggttacaa 29847779  T
201 gatgctccctgattggggctatggc 225  Q
    |||||||||||||||||||||||||    
29847780 gatgctccctgattggggctatggc 29847804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University