View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10500_low_48 (Length: 240)
Name: NF10500_low_48
Description: NF10500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10500_low_48 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 38368403 - 38368183
Alignment:
| Q |
20 |
caacacacagatcaatttggggacgagattgaggagacaagaaaaattggcaaaaatctttctaggcaagtttcaaaatgtcattgcgtccatgagaaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38368403 |
caacacacagatcaatttggggacgagattgaggagacaagaaaaattggcaaaaatctttctaggcaagtttcaaaatgtcattgcgtccatgagaaca |
38368304 |
T |
|
| Q |
120 |
aaacctaagattcatagattggaaggacaactgatttggttggtttctttctgcatgcagacttgttacttgatgtggctactgattttctgtttggaca |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38368303 |
aaaccgaagattcatagattggaaggacaactgatttggttggtttctttctgcatgcagacttgttacttgatgtggctactgattttctgtttggaca |
38368204 |
T |
|
| Q |
220 |
taaaatatgtagttggtgttt |
240 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
38368203 |
tataatatgtagttggtgttt |
38368183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 38378316 - 38378156
Alignment:
| Q |
18 |
atcaacacacagatcaatttggggacgagattgaggagacaagaaaaattggcaaaaatctttctaggcaagtttcaaaatgtcattgcgtccatgagaa |
117 |
Q |
| |
|
|||||| |||||||| |||||| || | |||||||||||||||||||||||||| |||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
38378316 |
atcaacgcacagatcgatttggagatgggattgaggagacaagaaaaattggcataaatctgtctaagcaagtttcaaaatgtcactgcgtccatgagaa |
38378217 |
T |
|
| Q |
118 |
caaaacctaagattcatagattggaaggacaactgatttggttggtttctttctgcatgca |
178 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38378216 |
caaaactgaagattcatagtttgggaggacaactgattaggttggtttctttctgcatgca |
38378156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 24 - 146
Target Start/End: Complemental strand, 38373127 - 38373005
Alignment:
| Q |
24 |
acacagatcaatttggggacgagattgaggagacaagaaaaattggcaaaaatctttctaggcaagtttcaaaatgtcattgcgtccatgagaacaaaac |
123 |
Q |
| |
|
|||||||||||||||| || | ||||||||| ||||||||||||| || |||||| |||| ||| | |||||||| ||||||||| | |||| |||||| |
|
|
| T |
38373127 |
acacagatcaatttggagatgcgattgaggaaacaagaaaaattgacataaatctatctaagcatgactcaaaatgccattgcgtctacgagagcaaaac |
38373028 |
T |
|
| Q |
124 |
ctaagattcatagattggaagga |
146 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
38373027 |
tgaagattgatagattggaagga |
38373005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University