View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10500_low_59 (Length: 219)
Name: NF10500_low_59
Description: NF10500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10500_low_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 38578843 - 38578660
Alignment:
| Q |
1 |
agaatgaggttcgtattaatgaggaaagaagggtttgtatgaatgcatggcaagaaagtgtggcataaggaatctggagatacgattgttcaaagcttaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38578843 |
agaatgaggttcatattaatgaggaaagaagggtttgtatgaatgcatggcaagaaagtgtggcataaggaatctggagatacgattgttcacagcttaa |
38578744 |
T |
|
| Q |
101 |
ataatgggaaagatggtagtgctgcaggttggagcacattaaagaaaatgaaagctcttttgttgaaggaagaatctaatagat |
184 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38578743 |
ataatgcgaaagatggtagtgctgcaggttggagcacattaaagaaaatgaaagctctttttttgaaggaagaatctaatagat |
38578660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University