View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10500_low_65 (Length: 205)
Name: NF10500_low_65
Description: NF10500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10500_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 36327751 - 36327591
Alignment:
| Q |
20 |
acgagtgtgttggtggaaatgtcataaactttcttgacagtcaaaaagaggaggacaatggaaacatcgtacactttcccgtcatgggaaatgcggtaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36327751 |
acgagtgtgttggtggaaatgtcataaactttcttgacagtcaaaaagaggaggacaatggaaacatcgtacactttcccgtcatgggaaatgcggtaaa |
36327652 |
T |
 |
| Q |
120 |
ctctcctgctgttggacacaaaggtggcggaggaaacgtcgttcactttccggggggtgga |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
36327651 |
ctctcctgctgttggacacaaaggtggcggaggaaacgtcgttcactttccaggcggtgga |
36327591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University