View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_high_7 (Length: 320)
Name: NF10501_high_7
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 16 - 148
Target Start/End: Complemental strand, 39899449 - 39899317
Alignment:
| Q |
16 |
cagcttgcaatatcctggaagaagaaatacacgagcgatggaagttgggaaagtttagtttgtgtactgctaaatattaaaagcatgatgctttagttga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39899449 |
cagcttgcaatatcctggaagaagaaatacacgagtgatggaagttgggaaagtttagtttgtgtgctgctaaatattaaaagcatgatgctttagttga |
39899350 |
T |
|
| Q |
116 |
aagaacnnnnnnngtattcgtcatatgaataat |
148 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
39899349 |
aagaagaaaaaaagtattcgtcatatgaataat |
39899317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 215 - 310
Target Start/End: Complemental strand, 39899248 - 39899153
Alignment:
| Q |
215 |
ctacacatgtgttatttttgtaagtttgatttctaatgtgacgtaggaagaggttgctgttgcgtttggcagaccagctcaattccagcgcctttg |
310 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
39899248 |
ctacagatgtgttatttttgtaagtttgatttctaatgtgacgtaggaagaggttgctgttgcgtttggcataccagctcaattccagcgcttttg |
39899153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 257 - 305
Target Start/End: Original strand, 38967964 - 38968012
Alignment:
| Q |
257 |
gtaggaagaggttgctgttgcgtttggcagaccagctcaattccagcgc |
305 |
Q |
| |
|
|||||||||||||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
38967964 |
gtaggaagaggttgctaaagagtttggcataccagctcaattccagcgc |
38968012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University